ID: 1005215090

View in Genome Browser
Species Human (GRCh38)
Location 6:23516934-23516956
Sequence TTAAATCTGCTTGGATTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005215085_1005215090 12 Left 1005215085 6:23516899-23516921 CCCTCCTTGAGAGACCAGGGATA No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data
1005215086_1005215090 11 Left 1005215086 6:23516900-23516922 CCTCCTTGAGAGACCAGGGATAA No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data
1005215087_1005215090 8 Left 1005215087 6:23516903-23516925 CCTTGAGAGACCAGGGATAACAA No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data
1005215081_1005215090 30 Left 1005215081 6:23516881-23516903 CCCAGAGATTCTCTTATGCCCTC No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data
1005215088_1005215090 -2 Left 1005215088 6:23516913-23516935 CCAGGGATAACAAAATATTACTT No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data
1005215082_1005215090 29 Left 1005215082 6:23516882-23516904 CCAGAGATTCTCTTATGCCCTCC No data
Right 1005215090 6:23516934-23516956 TTAAATCTGCTTGGATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005215090 Original CRISPR TTAAATCTGCTTGGATTTTT AGG Intergenic