ID: 1005215091

View in Genome Browser
Species Human (GRCh38)
Location 6:23516941-23516963
Sequence TGCTTGGATTTTTAGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005215087_1005215091 15 Left 1005215087 6:23516903-23516925 CCTTGAGAGACCAGGGATAACAA No data
Right 1005215091 6:23516941-23516963 TGCTTGGATTTTTAGGAAACTGG No data
1005215086_1005215091 18 Left 1005215086 6:23516900-23516922 CCTCCTTGAGAGACCAGGGATAA No data
Right 1005215091 6:23516941-23516963 TGCTTGGATTTTTAGGAAACTGG No data
1005215088_1005215091 5 Left 1005215088 6:23516913-23516935 CCAGGGATAACAAAATATTACTT No data
Right 1005215091 6:23516941-23516963 TGCTTGGATTTTTAGGAAACTGG No data
1005215085_1005215091 19 Left 1005215085 6:23516899-23516921 CCCTCCTTGAGAGACCAGGGATA No data
Right 1005215091 6:23516941-23516963 TGCTTGGATTTTTAGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005215091 Original CRISPR TGCTTGGATTTTTAGGAAAC TGG Intergenic