ID: 1005219601

View in Genome Browser
Species Human (GRCh38)
Location 6:23571794-23571816
Sequence ATGTGTCACATGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005219601_1005219608 19 Left 1005219601 6:23571794-23571816 CCTCTCTGCTGCATGTGACACAT No data
Right 1005219608 6:23571836-23571858 CACCTTCCACCATCGGTGGAAGG No data
1005219601_1005219607 15 Left 1005219601 6:23571794-23571816 CCTCTCTGCTGCATGTGACACAT No data
Right 1005219607 6:23571832-23571854 CATTCACCTTCCACCATCGGTGG No data
1005219601_1005219604 12 Left 1005219601 6:23571794-23571816 CCTCTCTGCTGCATGTGACACAT No data
Right 1005219604 6:23571829-23571851 ACCCATTCACCTTCCACCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005219601 Original CRISPR ATGTGTCACATGCAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr