ID: 1005224969

View in Genome Browser
Species Human (GRCh38)
Location 6:23632164-23632186
Sequence TGGTGTCTTCACACTGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005224969_1005224972 -4 Left 1005224969 6:23632164-23632186 CCAACAACAGTGTGAAGACACCA No data
Right 1005224972 6:23632183-23632205 ACCATTGGCTGTCCCTCTGTGGG No data
1005224969_1005224976 1 Left 1005224969 6:23632164-23632186 CCAACAACAGTGTGAAGACACCA No data
Right 1005224976 6:23632188-23632210 TGGCTGTCCCTCTGTGGGGGTGG No data
1005224969_1005224974 -3 Left 1005224969 6:23632164-23632186 CCAACAACAGTGTGAAGACACCA No data
Right 1005224974 6:23632184-23632206 CCATTGGCTGTCCCTCTGTGGGG No data
1005224969_1005224977 2 Left 1005224969 6:23632164-23632186 CCAACAACAGTGTGAAGACACCA No data
Right 1005224977 6:23632189-23632211 GGCTGTCCCTCTGTGGGGGTGGG No data
1005224969_1005224975 -2 Left 1005224969 6:23632164-23632186 CCAACAACAGTGTGAAGACACCA No data
Right 1005224975 6:23632185-23632207 CATTGGCTGTCCCTCTGTGGGGG No data
1005224969_1005224971 -5 Left 1005224969 6:23632164-23632186 CCAACAACAGTGTGAAGACACCA No data
Right 1005224971 6:23632182-23632204 CACCATTGGCTGTCCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005224969 Original CRISPR TGGTGTCTTCACACTGTTGT TGG (reversed) Intergenic
No off target data available for this crispr