ID: 1005224976

View in Genome Browser
Species Human (GRCh38)
Location 6:23632188-23632210
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005224969_1005224976 1 Left 1005224969 6:23632164-23632186 CCAACAACAGTGTGAAGACACCA No data
Right 1005224976 6:23632188-23632210 TGGCTGTCCCTCTGTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005224976 Original CRISPR TGGCTGTCCCTCTGTGGGGG TGG Intergenic
No off target data available for this crispr