ID: 1005239015

View in Genome Browser
Species Human (GRCh38)
Location 6:23802755-23802777
Sequence GTGGCATAGGTAAGAATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005239015_1005239023 19 Left 1005239015 6:23802755-23802777 CCAGGGATTCTTACCTATGCCAC No data
Right 1005239023 6:23802797-23802819 CCATCTTCTAAGTGGAGATAGGG No data
1005239015_1005239020 11 Left 1005239015 6:23802755-23802777 CCAGGGATTCTTACCTATGCCAC No data
Right 1005239020 6:23802789-23802811 AAGTATCACCATCTTCTAAGTGG No data
1005239015_1005239021 18 Left 1005239015 6:23802755-23802777 CCAGGGATTCTTACCTATGCCAC No data
Right 1005239021 6:23802796-23802818 ACCATCTTCTAAGTGGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005239015 Original CRISPR GTGGCATAGGTAAGAATCCC TGG (reversed) Intergenic
No off target data available for this crispr