ID: 1005239023

View in Genome Browser
Species Human (GRCh38)
Location 6:23802797-23802819
Sequence CCATCTTCTAAGTGGAGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005239019_1005239023 -4 Left 1005239019 6:23802778-23802800 CCAATACTTCAAAGTATCACCAT No data
Right 1005239023 6:23802797-23802819 CCATCTTCTAAGTGGAGATAGGG No data
1005239018_1005239023 -3 Left 1005239018 6:23802777-23802799 CCCAATACTTCAAAGTATCACCA No data
Right 1005239023 6:23802797-23802819 CCATCTTCTAAGTGGAGATAGGG No data
1005239016_1005239023 6 Left 1005239016 6:23802768-23802790 CCTATGCCACCCAATACTTCAAA No data
Right 1005239023 6:23802797-23802819 CCATCTTCTAAGTGGAGATAGGG No data
1005239015_1005239023 19 Left 1005239015 6:23802755-23802777 CCAGGGATTCTTACCTATGCCAC No data
Right 1005239023 6:23802797-23802819 CCATCTTCTAAGTGGAGATAGGG No data
1005239017_1005239023 0 Left 1005239017 6:23802774-23802796 CCACCCAATACTTCAAAGTATCA No data
Right 1005239023 6:23802797-23802819 CCATCTTCTAAGTGGAGATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005239023 Original CRISPR CCATCTTCTAAGTGGAGATA GGG Intergenic
No off target data available for this crispr