ID: 1005244045

View in Genome Browser
Species Human (GRCh38)
Location 6:23861631-23861653
Sequence TTGAATAAGTGTGATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005244045_1005244051 18 Left 1005244045 6:23861631-23861653 CCATTCTCATCACACTTATTCAA No data
Right 1005244051 6:23861672-23861694 AGATTAAGATGGCAGATAGGAGG No data
1005244045_1005244046 -10 Left 1005244045 6:23861631-23861653 CCATTCTCATCACACTTATTCAA No data
Right 1005244046 6:23861644-23861666 ACTTATTCAATAGTGCTGAAAGG No data
1005244045_1005244050 15 Left 1005244045 6:23861631-23861653 CCATTCTCATCACACTTATTCAA No data
Right 1005244050 6:23861669-23861691 AGGAGATTAAGATGGCAGATAGG No data
1005244045_1005244049 7 Left 1005244045 6:23861631-23861653 CCATTCTCATCACACTTATTCAA No data
Right 1005244049 6:23861661-23861683 GAAAGGGAAGGAGATTAAGATGG No data
1005244045_1005244048 -5 Left 1005244045 6:23861631-23861653 CCATTCTCATCACACTTATTCAA No data
Right 1005244048 6:23861649-23861671 TTCAATAGTGCTGAAAGGGAAGG No data
1005244045_1005244047 -9 Left 1005244045 6:23861631-23861653 CCATTCTCATCACACTTATTCAA No data
Right 1005244047 6:23861645-23861667 CTTATTCAATAGTGCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005244045 Original CRISPR TTGAATAAGTGTGATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr