ID: 1005246638

View in Genome Browser
Species Human (GRCh38)
Location 6:23893230-23893252
Sequence CCATCCCAACATAAGAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005246638_1005246643 10 Left 1005246638 6:23893230-23893252 CCTAGATTCTTATGTTGGGATGG No data
Right 1005246643 6:23893263-23893285 TCCACATAGTCCTCTTGGGAAGG No data
1005246638_1005246642 6 Left 1005246638 6:23893230-23893252 CCTAGATTCTTATGTTGGGATGG No data
Right 1005246642 6:23893259-23893281 CCTTTCCACATAGTCCTCTTGGG No data
1005246638_1005246640 5 Left 1005246638 6:23893230-23893252 CCTAGATTCTTATGTTGGGATGG No data
Right 1005246640 6:23893258-23893280 TCCTTTCCACATAGTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005246638 Original CRISPR CCATCCCAACATAAGAATCT AGG (reversed) Intergenic
No off target data available for this crispr