ID: 1005249760

View in Genome Browser
Species Human (GRCh38)
Location 6:23930959-23930981
Sequence GATTGGTGCAGAGCCCTCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005249760_1005249765 29 Left 1005249760 6:23930959-23930981 CCAAAGAGGGCTCTGCACCAATC No data
Right 1005249765 6:23931011-23931033 TTCGTCAAGTAAGAAGAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005249760 Original CRISPR GATTGGTGCAGAGCCCTCTT TGG (reversed) Intergenic
No off target data available for this crispr