ID: 1005250418

View in Genome Browser
Species Human (GRCh38)
Location 6:23939734-23939756
Sequence CAGTGTGGTCTGAGTGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005250418_1005250422 30 Left 1005250418 6:23939734-23939756 CCAACCACACTCAGACCACACTG No data
Right 1005250422 6:23939787-23939809 CTCAAAACCATACTATTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005250418 Original CRISPR CAGTGTGGTCTGAGTGTGGT TGG (reversed) Intergenic
No off target data available for this crispr