ID: 1005250418 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:23939734-23939756 |
Sequence | CAGTGTGGTCTGAGTGTGGT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1005250418_1005250422 | 30 | Left | 1005250418 | 6:23939734-23939756 | CCAACCACACTCAGACCACACTG | No data | ||
Right | 1005250422 | 6:23939787-23939809 | CTCAAAACCATACTATTACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1005250418 | Original CRISPR | CAGTGTGGTCTGAGTGTGGT TGG (reversed) | Intergenic | ||
No off target data available for this crispr |