ID: 1005253443

View in Genome Browser
Species Human (GRCh38)
Location 6:23973104-23973126
Sequence CTGGTGTTGTGTCCTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005253438_1005253443 8 Left 1005253438 6:23973073-23973095 CCCAGGCTTAATATCCACTGAAA No data
Right 1005253443 6:23973104-23973126 CTGGTGTTGTGTCCTGTGTCTGG No data
1005253439_1005253443 7 Left 1005253439 6:23973074-23973096 CCAGGCTTAATATCCACTGAAAT No data
Right 1005253443 6:23973104-23973126 CTGGTGTTGTGTCCTGTGTCTGG No data
1005253437_1005253443 9 Left 1005253437 6:23973072-23973094 CCCCAGGCTTAATATCCACTGAA No data
Right 1005253443 6:23973104-23973126 CTGGTGTTGTGTCCTGTGTCTGG No data
1005253441_1005253443 -6 Left 1005253441 6:23973087-23973109 CCACTGAAATTTCACCTCTGGTG No data
Right 1005253443 6:23973104-23973126 CTGGTGTTGTGTCCTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005253443 Original CRISPR CTGGTGTTGTGTCCTGTGTC TGG Intergenic
No off target data available for this crispr