ID: 1005254553

View in Genome Browser
Species Human (GRCh38)
Location 6:23986775-23986797
Sequence CTGTGGACACGGAGCCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005254548_1005254553 25 Left 1005254548 6:23986727-23986749 CCATGTGAACATGCAGTTCGGCA No data
Right 1005254553 6:23986775-23986797 CTGTGGACACGGAGCCATGAAGG No data
1005254549_1005254553 1 Left 1005254549 6:23986751-23986773 CCAGCTGAGATCACACTGCTGCC No data
Right 1005254553 6:23986775-23986797 CTGTGGACACGGAGCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005254553 Original CRISPR CTGTGGACACGGAGCCATGA AGG Intergenic
No off target data available for this crispr