ID: 1005256292

View in Genome Browser
Species Human (GRCh38)
Location 6:24007002-24007024
Sequence AGCAAAAATGTCTCCAGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005256292_1005256295 -4 Left 1005256292 6:24007002-24007024 CCACGTCTGGAGACATTTTTGCT No data
Right 1005256295 6:24007021-24007043 TGCTGGTCATAACTCCAGGTAGG No data
1005256292_1005256294 -8 Left 1005256292 6:24007002-24007024 CCACGTCTGGAGACATTTTTGCT No data
Right 1005256294 6:24007017-24007039 TTTTTGCTGGTCATAACTCCAGG No data
1005256292_1005256300 14 Left 1005256292 6:24007002-24007024 CCACGTCTGGAGACATTTTTGCT No data
Right 1005256300 6:24007039-24007061 GTAGGAGGAGAGGGTCAAACTGG No data
1005256292_1005256297 4 Left 1005256292 6:24007002-24007024 CCACGTCTGGAGACATTTTTGCT No data
Right 1005256297 6:24007029-24007051 ATAACTCCAGGTAGGAGGAGAGG No data
1005256292_1005256296 -1 Left 1005256292 6:24007002-24007024 CCACGTCTGGAGACATTTTTGCT No data
Right 1005256296 6:24007024-24007046 TGGTCATAACTCCAGGTAGGAGG No data
1005256292_1005256298 5 Left 1005256292 6:24007002-24007024 CCACGTCTGGAGACATTTTTGCT No data
Right 1005256298 6:24007030-24007052 TAACTCCAGGTAGGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005256292 Original CRISPR AGCAAAAATGTCTCCAGACG TGG (reversed) Intergenic
No off target data available for this crispr