ID: 1005258347

View in Genome Browser
Species Human (GRCh38)
Location 6:24029253-24029275
Sequence TAAGCCTCATGGTTCAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005258347_1005258351 14 Left 1005258347 6:24029253-24029275 CCCAAATTGAACCATGAGGCTTA No data
Right 1005258351 6:24029290-24029312 TGTACCCCATCCTTGGCCTCCGG No data
1005258347_1005258350 7 Left 1005258347 6:24029253-24029275 CCCAAATTGAACCATGAGGCTTA No data
Right 1005258350 6:24029283-24029305 AATGAGATGTACCCCATCCTTGG No data
1005258347_1005258356 24 Left 1005258347 6:24029253-24029275 CCCAAATTGAACCATGAGGCTTA No data
Right 1005258356 6:24029300-24029322 CCTTGGCCTCCGGAGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005258347 Original CRISPR TAAGCCTCATGGTTCAATTT GGG (reversed) Intergenic
No off target data available for this crispr