ID: 1005259473

View in Genome Browser
Species Human (GRCh38)
Location 6:24042695-24042717
Sequence CTGCAGCCACTGTGGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005259467_1005259473 -7 Left 1005259467 6:24042679-24042701 CCTTGGTCAGGGCTTGCTGCAGC No data
Right 1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005259473 Original CRISPR CTGCAGCCACTGTGGGGGCT GGG Intergenic
No off target data available for this crispr