ID: 1005259974

View in Genome Browser
Species Human (GRCh38)
Location 6:24048414-24048436
Sequence GAGCAGCATTTTAAGTCGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005259974_1005259978 26 Left 1005259974 6:24048414-24048436 CCTACCGACTTAAAATGCTGCTC No data
Right 1005259978 6:24048463-24048485 TAGAATTTTGTCACACTACTGGG No data
1005259974_1005259976 -1 Left 1005259974 6:24048414-24048436 CCTACCGACTTAAAATGCTGCTC No data
Right 1005259976 6:24048436-24048458 CATCTTCTGTAAATTAGCAATGG No data
1005259974_1005259977 25 Left 1005259974 6:24048414-24048436 CCTACCGACTTAAAATGCTGCTC No data
Right 1005259977 6:24048462-24048484 ATAGAATTTTGTCACACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005259974 Original CRISPR GAGCAGCATTTTAAGTCGGT AGG (reversed) Intergenic
No off target data available for this crispr