ID: 1005259976

View in Genome Browser
Species Human (GRCh38)
Location 6:24048436-24048458
Sequence CATCTTCTGTAAATTAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005259972_1005259976 20 Left 1005259972 6:24048393-24048415 CCCTAAGCGAGTCTACAAAAGCC No data
Right 1005259976 6:24048436-24048458 CATCTTCTGTAAATTAGCAATGG No data
1005259974_1005259976 -1 Left 1005259974 6:24048414-24048436 CCTACCGACTTAAAATGCTGCTC No data
Right 1005259976 6:24048436-24048458 CATCTTCTGTAAATTAGCAATGG No data
1005259973_1005259976 19 Left 1005259973 6:24048394-24048416 CCTAAGCGAGTCTACAAAAGCCT No data
Right 1005259976 6:24048436-24048458 CATCTTCTGTAAATTAGCAATGG No data
1005259975_1005259976 -5 Left 1005259975 6:24048418-24048440 CCGACTTAAAATGCTGCTCATCT No data
Right 1005259976 6:24048436-24048458 CATCTTCTGTAAATTAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005259976 Original CRISPR CATCTTCTGTAAATTAGCAA TGG Intergenic
No off target data available for this crispr