ID: 1005259978

View in Genome Browser
Species Human (GRCh38)
Location 6:24048463-24048485
Sequence TAGAATTTTGTCACACTACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005259974_1005259978 26 Left 1005259974 6:24048414-24048436 CCTACCGACTTAAAATGCTGCTC No data
Right 1005259978 6:24048463-24048485 TAGAATTTTGTCACACTACTGGG No data
1005259975_1005259978 22 Left 1005259975 6:24048418-24048440 CCGACTTAAAATGCTGCTCATCT No data
Right 1005259978 6:24048463-24048485 TAGAATTTTGTCACACTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005259978 Original CRISPR TAGAATTTTGTCACACTACT GGG Intergenic
No off target data available for this crispr