ID: 1005264979

View in Genome Browser
Species Human (GRCh38)
Location 6:24102169-24102191
Sequence ACCCTTCAGCTCCCACGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005264979_1005264981 3 Left 1005264979 6:24102169-24102191 CCTTAACGTGGGAGCTGAAGGGT No data
Right 1005264981 6:24102195-24102217 TTGGACCGTATTAGCCATGTAGG 0: 2
1: 9
2: 9
3: 41
4: 1667

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005264979 Original CRISPR ACCCTTCAGCTCCCACGTTA AGG (reversed) Intergenic
No off target data available for this crispr