ID: 1005266804

View in Genome Browser
Species Human (GRCh38)
Location 6:24120688-24120710
Sequence TTGGCTGCAGAACTGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005266804_1005266807 15 Left 1005266804 6:24120688-24120710 CCCTGCATCAGTTCTGCAGCCAA No data
Right 1005266807 6:24120726-24120748 TTCTATGCTCCTGCTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005266804 Original CRISPR TTGGCTGCAGAACTGATGCA GGG (reversed) Intergenic
No off target data available for this crispr