ID: 1005267311

View in Genome Browser
Species Human (GRCh38)
Location 6:24125977-24125999
Sequence CCATCCTGGGGAGCCTCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005267311 Original CRISPR CCATCCTGGGGAGCCTCGGC AGG Intergenic