ID: 1005267413

View in Genome Browser
Species Human (GRCh38)
Location 6:24126431-24126453
Sequence TTATGCATGAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 347}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005267413 Original CRISPR TTATGCATGAAGAAGGAGGA AGG (reversed) Intronic
902908693 1:19578944-19578966 TGATGCAAGAAGAGAGAGGAGGG - Intergenic
903975650 1:27148269-27148291 ATTTGCATGAAGGAGGATGAGGG - Intronic
905330596 1:37193047-37193069 TGGAGCATGAAGAAGGAGGTTGG - Intergenic
905955884 1:41995508-41995530 TTCTTCATGAAGAAGAAGAAAGG + Intronic
907675652 1:56515577-56515599 TTATGAATGAGAAAGGAGTAGGG + Intronic
909519773 1:76554103-76554125 TTCTACATGATGAAGGGGGAAGG - Intronic
910508300 1:87975740-87975762 TTATCTCTGAAGATGGAGGAAGG - Intergenic
911503501 1:98718737-98718759 ATATGCATAAAGAAAGTGGAAGG - Intronic
914689792 1:150015685-150015707 GCATGGAGGAAGAAGGAGGATGG - Intergenic
915119492 1:153619988-153620010 TTAAGAAAGAAGAAGCAGGAAGG + Intronic
916169322 1:161988727-161988749 GTCTGCAGGAAGAATGAGGAGGG - Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
917910534 1:179640162-179640184 ATATGCACTAAGAAGAAGGAAGG - Intronic
918056450 1:181025647-181025669 TGATGAAAGAAGAGGGAGGAAGG + Intergenic
918248817 1:182684078-182684100 TTAGGGTTGAGGAAGGAGGATGG + Intronic
918355017 1:183699816-183699838 TTGGGCTTGAAGAATGAGGAAGG - Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
918976759 1:191498310-191498332 TTAAGCATAAAGAAGGGGAAGGG - Intergenic
919267452 1:195288994-195289016 TTATCTCTGAAGATGGAGGAAGG + Intergenic
919718248 1:200803008-200803030 TTATGGAAGAAAAAGCAGGAGGG - Intronic
919983411 1:202656740-202656762 TCCTGCATGAAGCAGGAGGTTGG - Intronic
920815864 1:209331367-209331389 TTCTGCCAGAAGAGGGAGGAAGG + Intergenic
921555809 1:216597417-216597439 CTGTGCATGAAGAAGATGGAAGG + Intronic
922034759 1:221837561-221837583 TAATGCAACAAGAAGGATGAAGG - Intergenic
923111265 1:230892311-230892333 TGAAGCATGAAGAAAGTGGAAGG + Intergenic
923314699 1:232768521-232768543 TTGTCCATCAAGCAGGAGGATGG - Intergenic
924082211 1:240411062-240411084 TAATACAAGAAGAAGTAGGATGG - Intronic
924785994 1:247200352-247200374 TTAATCCTGAAGAAAGAGGATGG + Intergenic
924791520 1:247254688-247254710 GTAGACATGAAGTAGGAGGAAGG - Intergenic
1063185489 10:3646891-3646913 CCATGCAGGAGGAAGGAGGAAGG + Intergenic
1063548710 10:7007595-7007617 GTAGGGATAAAGAAGGAGGAAGG - Intergenic
1064113924 10:12561502-12561524 GTATGCAGCAAAAAGGAGGAAGG - Intronic
1064748431 10:18501035-18501057 TTATGTATTAACAAGGAGGCTGG + Intronic
1067897417 10:50199274-50199296 TTATGTATGACAAAAGAGGATGG + Intronic
1067951555 10:50742765-50742787 TTATGTATGACAAAAGAGGATGG - Intronic
1068199586 10:53765688-53765710 TTTGGCCTGAAGCAGGAGGATGG + Intergenic
1068503706 10:57871922-57871944 TTATGAATCAATAAGGAAGAAGG - Intergenic
1068884234 10:62082008-62082030 TTAAGAAAGAAGAATGAGGAGGG + Intronic
1069058629 10:63870739-63870761 ATTCTCATGAAGAAGGAGGATGG - Intergenic
1070714281 10:78707927-78707949 GTGTGCATACAGAAGGAGGAAGG - Intergenic
1072133672 10:92522248-92522270 TTTTGCATAGAGAAGTAGGAAGG - Intronic
1072738838 10:97897253-97897275 TGATGGATGAAGAAGGGGCAGGG + Intronic
1074079007 10:110152684-110152706 TTCTGAATGGGGAAGGAGGAAGG + Intergenic
1074441428 10:113480435-113480457 TTAGGTAGGAAGAAGGAGAATGG + Intergenic
1076109814 10:127851728-127851750 TTCTGCAGCTAGAAGGAGGATGG + Intergenic
1078889448 11:15541017-15541039 TCATGCATAAAGAAGTAGAAAGG + Intergenic
1079216150 11:18513763-18513785 TTATTCTTGATGAAGGATGAAGG - Intronic
1079335298 11:19565387-19565409 TCTTGGATGAAGAGGGAGGAGGG - Intronic
1080060669 11:27953429-27953451 TAATTAATGAAGAAGGAAGAAGG + Intergenic
1081351094 11:42053091-42053113 TTACACACAAAGAAGGAGGAAGG - Intergenic
1083142114 11:60730489-60730511 TCATCCATGAAGATGAAGGAGGG + Intronic
1085900568 11:80695056-80695078 CTATGTATGGAGAAGGAGGTGGG - Intergenic
1086988449 11:93275887-93275909 CTATGGGTGAAGAAGGAGGGTGG + Intergenic
1087677650 11:101181213-101181235 ATAAGAATGAAGAAGGAAGAAGG + Intergenic
1088074275 11:105827037-105827059 TTCTGGATGAGGAAGGATGAAGG - Intronic
1088506764 11:110534824-110534846 CTAGGCAGGAAGAAGGAGAAAGG + Intergenic
1089320920 11:117626204-117626226 TCATGCCAGAAGAAGGAGGGGGG - Intronic
1091757247 12:3062085-3062107 CTAAGCATGATAAAGGAGGAAGG - Intergenic
1092641249 12:10513067-10513089 TTTTGAATGAGGTAGGAGGACGG - Intronic
1094237843 12:28189212-28189234 GTATGCATAAAGAAGGGGGTGGG + Intronic
1098525253 12:71480065-71480087 TTAAGAATGAGGAAGGAGGCTGG + Intronic
1099383601 12:81986310-81986332 TTATTGATGAAGAAAGACGATGG + Intergenic
1101627748 12:106462127-106462149 TGTAGCATGAAGCAGGAGGAGGG - Intronic
1102461433 12:113102086-113102108 TTTTACAGGAAGAAGGAGCACGG - Intronic
1102756902 12:115348899-115348921 CCATGCATGAGGAAGGAGGGTGG + Intergenic
1105649308 13:22357257-22357279 TTCTGCATGAAGGAGGTGGCTGG + Intergenic
1107728078 13:43320003-43320025 TGTTGCTTGAAGCAGGAGGATGG - Intronic
1108128968 13:47276557-47276579 CAAGGCATGGAGAAGGAGGAAGG + Intergenic
1108732872 13:53253265-53253287 TTAACCATGAGGAAGGAGGAAGG + Intergenic
1108747709 13:53411779-53411801 TTATGTAAGAAGACAGAGGAGGG - Intergenic
1108995344 13:56725957-56725979 TAATGTATGAAGAAGAATGATGG + Intergenic
1109365628 13:61352493-61352515 TTATGTAAGAAAAAGAAGGAAGG - Intergenic
1110700387 13:78540626-78540648 CTCTGCAAGAAGAAGGAGGATGG - Intergenic
1113195252 13:107796671-107796693 TTATGATTGGTGAAGGAGGAAGG - Intronic
1113244385 13:108377888-108377910 TTCTGCTTGAAGAAAGGGGAGGG + Intergenic
1116354878 14:43915096-43915118 TTCTGCTTGAGGAAAGAGGAGGG + Intergenic
1117062823 14:51980594-51980616 TTAGGCAGGGAGAAAGAGGAAGG + Intergenic
1117399463 14:55345513-55345535 GTATGGATGAAGAGGGAGAAGGG - Intronic
1118300960 14:64615594-64615616 TTATGCATTAAAAAATAGGAAGG + Intergenic
1120316339 14:82898320-82898342 GGATGCATAGAGAAGGAGGAAGG - Intergenic
1120385076 14:83834582-83834604 CTATCCATGAAGAAGGAAGAGGG - Intergenic
1122206024 14:100148440-100148462 TTCTGAATGAGAAAGGAGGAAGG - Intronic
1123927622 15:25133850-25133872 TTTTACATGGACAAGGAGGAGGG - Intergenic
1124171848 15:27381330-27381352 TCATGCCTTCAGAAGGAGGAGGG - Intronic
1125881140 15:43197073-43197095 TTATGCAGGAAGATGAAGGGAGG - Exonic
1126167464 15:45666035-45666057 TTAAGCCTGGAGAAGGAGCAAGG - Intronic
1126386970 15:48103442-48103464 ATATCCATGAAGAGAGAGGAAGG + Intergenic
1126551084 15:49930238-49930260 TTAGGGATGAAGAGGGAGGATGG + Intronic
1129452611 15:75659330-75659352 TTGTGCAGGAAGATGGAGAAGGG + Exonic
1130029531 15:80299000-80299022 TTAAGAATGAAGAGGTAGGAGGG + Intergenic
1131000135 15:88933350-88933372 TGAGGGATGAAGAAGGAGGGCGG - Intergenic
1131133307 15:89913529-89913551 CTGTGCAGGAAGAAGGAGGGAGG - Intergenic
1131919604 15:97309851-97309873 TTATGCTTCCAGCAGGAGGAGGG - Intergenic
1132245119 15:100289442-100289464 TTATGAAATATGAAGGAGGAGGG + Intronic
1133686980 16:8174771-8174793 TCAAGTATGTAGAAGGAGGATGG - Intergenic
1135539347 16:23317950-23317972 TTCTGCAGGAAGAAGGAGGCTGG - Intronic
1135862241 16:26067311-26067333 TTATGCATTCAAAATGAGGAGGG - Intronic
1136014676 16:27388462-27388484 TTAGGCAGGAGAAAGGAGGAAGG + Intergenic
1136427453 16:30178588-30178610 TTCTCCATGGAGAAGGCGGAGGG + Intergenic
1136682359 16:31975783-31975805 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1136782617 16:32916951-32916973 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1136887177 16:33936899-33936921 CTATGCATGTGGAAGGAGAAAGG + Intergenic
1137776066 16:51055240-51055262 TTATCCATGAAGAAGAGGAATGG + Intergenic
1137932695 16:52603782-52603804 TAATTCCTGCAGAAGGAGGAAGG + Intergenic
1138567847 16:57846413-57846435 TGATGGCTGAAGAAGGCGGATGG + Intronic
1140507600 16:75483696-75483718 ATATCCAGTAAGAAGGAGGAAGG + Intronic
1141216252 16:82027016-82027038 TAATGCCTGAAAGAGGAGGAAGG + Intergenic
1141261245 16:82455674-82455696 TTATGTATACAGAAGCAGGAAGG - Intergenic
1142250117 16:88987769-88987791 TAATACATGAAGAAAGAGGCAGG + Intergenic
1203085275 16_KI270728v1_random:1180939-1180961 CTATGCATGTGGAAGGAGAAAGG - Intergenic
1142878596 17:2867436-2867458 TTATCCACGAAGATGGACGATGG + Intronic
1143768171 17:9151064-9151086 TTCTGCTTGAAGAAGGAGACAGG + Intronic
1144047802 17:11469310-11469332 AGATGCCTGAAGATGGAGGAAGG + Intronic
1144295357 17:13870085-13870107 ATATGCATGAGGCATGAGGAAGG - Intergenic
1147142879 17:38469121-38469143 CTATGCATGTGGAAGGAGAAAGG - Intronic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1147791659 17:43017738-43017760 TTTTGAATGAAGAAGGGGTAGGG - Intronic
1150039616 17:61845743-61845765 TTTTGCATACAGAAGCAGGATGG - Intronic
1150114909 17:62538718-62538740 TCATGTATGAAGAAGGAACATGG + Intronic
1150888309 17:69113585-69113607 TTATGCATGGGGAAGGAAGCAGG - Intronic
1152137321 17:78512153-78512175 CTATGCAGGAAGTAGGAGAATGG - Intronic
1152496778 17:80678730-80678752 TAATGCATGAAGAAGGTGGAAGG + Intronic
1153440307 18:5110453-5110475 TTATAAAAGAAGCAGGAGGATGG + Intergenic
1153763159 18:8351099-8351121 TTAAGCAGGCATAAGGAGGAAGG - Intronic
1155112476 18:22729673-22729695 CTAGGCAGAAAGAAGGAGGAAGG - Intergenic
1156491987 18:37501714-37501736 GTAGGTAGGAAGAAGGAGGAGGG + Intronic
1157306984 18:46524736-46524758 CTCTCCCTGAAGAAGGAGGATGG - Exonic
1157577657 18:48754471-48754493 TTGTGCAGGAAGAAGGAAAAGGG + Intronic
1157990326 18:52487978-52488000 TTATGCACTAAGAAAGATGATGG + Intronic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1158617515 18:59001765-59001787 ATAAGTATGAAGAAAGAGGAAGG - Intergenic
1158665970 18:59433109-59433131 TTTTGCAGAGAGAAGGAGGAAGG + Exonic
1158831533 18:61284659-61284681 TCATGCATGAAGCTGCAGGAAGG - Intergenic
1159349251 18:67250406-67250428 TTCTGGATGATGAAGGTGGATGG + Intergenic
1159362821 18:67427352-67427374 GTAGGAATGCAGAAGGAGGAAGG - Intergenic
1159932005 18:74322377-74322399 TTAGGCATGAATAAGGAAAATGG - Intronic
1160118618 18:76106779-76106801 TTATAAATGAAGGAGGATGAAGG - Intergenic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1162467784 19:10852859-10852881 TTATGGGTCAAGAAGCAGGAGGG + Intronic
1165074035 19:33270810-33270832 TTATCCAGGAGGAAGGAGCAGGG - Intergenic
1165252485 19:34551598-34551620 TCATGCTTCAAGCAGGAGGAAGG - Intergenic
1166348868 19:42184527-42184549 TGATGCATGACTAAGGACGAAGG + Intronic
1166975447 19:46602580-46602602 TTCTTCCTGAGGAAGGAGGACGG - Intronic
925501084 2:4505628-4505650 TTAAGCAGAAAGAAGGTGGAAGG - Intergenic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926434144 2:12821509-12821531 TGATGTAAGAAGAAGGAGGAAGG - Intergenic
926493384 2:13553807-13553829 TTATGCATGAGCAAAGAGAATGG - Intergenic
926988203 2:18647236-18647258 TTATGTAGGAGGTAGGAGGAAGG - Intergenic
929627499 2:43424576-43424598 TTATTCATGAAGAAAGTGGAAGG - Intronic
930936634 2:56960616-56960638 GAGTGCATGAGGAAGGAGGAAGG + Intergenic
930979802 2:57510100-57510122 ATATGTGTAAAGAAGGAGGATGG + Intergenic
931059031 2:58505431-58505453 TTATGCATGAATAAGTATTAGGG - Intergenic
931097470 2:58957453-58957475 CCAGGCAGGAAGAAGGAGGAGGG - Intergenic
932697664 2:73970208-73970230 TTATGAATGAATAAGCAGCATGG + Intergenic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
936049152 2:109210137-109210159 TTATTCAGCATGAAGGAGGAAGG - Intronic
936226802 2:110661968-110661990 GAATGCTTGAAGAAGGAGTATGG - Intronic
936800795 2:116262485-116262507 TCAAACATGAAGAAGGAGGCAGG + Intergenic
937446420 2:121962564-121962586 TCATCCAGGAAGAAGGAGGAAGG + Intergenic
937478517 2:122236415-122236437 TCATTCAGGAAGCAGGAGGAGGG + Intergenic
938388473 2:130884912-130884934 TTATTGATGAAGAAGCTGGAGGG - Intronic
938659789 2:133473884-133473906 AAATGCATAAAGCAGGAGGAAGG + Intronic
939246270 2:139627152-139627174 TTGTGCATGAAAAAGGAGGCTGG + Intergenic
939459434 2:142480234-142480256 TTGGGCATGAAAAATGAGGAAGG + Intergenic
939716575 2:145591347-145591369 TTAAGCATTAAGGATGAGGAAGG - Intergenic
940511004 2:154614870-154614892 ATATGCAGGAACATGGAGGATGG + Intergenic
940697753 2:157001161-157001183 TTATGATTGAAGAAGTGGGAAGG + Intergenic
941065964 2:160903116-160903138 ATAAGCATGAAGAAGGCAGATGG - Intergenic
941554284 2:166956732-166956754 TTAGGCAGGAAGAAGGGGAAAGG + Intronic
942523136 2:176825656-176825678 TCTTGCATGGGGAAGGAGGAAGG - Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943900076 2:193422509-193422531 TTATGCATGGAGAAAGAGTGGGG + Intergenic
943921541 2:193713275-193713297 TAATGCAAGAAGAAGGAGAAGGG - Intergenic
944832910 2:203550596-203550618 TTAGGAATGAAGAATGAGGTGGG + Intergenic
944860623 2:203812497-203812519 TCATGCTGGAAGAAGGAGGTAGG + Intergenic
945436458 2:209824346-209824368 TTAGGTATGAAGAAGCAGCATGG + Intronic
945472486 2:210242800-210242822 TTAGGGATGAGCAAGGAGGAGGG - Intergenic
945523442 2:210858709-210858731 CTATGTGTGAAGAAGGATGACGG - Intergenic
946116292 2:217465359-217465381 TCATGCATGAAGCAGGAGAGAGG + Intronic
946546337 2:220748667-220748689 ATTTGTATGAAGAAGGAGGAAGG + Intergenic
946647423 2:221852685-221852707 TGATCCATGAAGAACGTGGATGG - Intergenic
946906356 2:224420272-224420294 TTATGCAGGATAAAGGAGGGAGG - Intergenic
947328949 2:229008123-229008145 TTATGAATAAATAAGGGGGAAGG - Intronic
947349464 2:229227670-229227692 TTAGGGATGAAGAAAGAGCAAGG - Intronic
947767179 2:232645276-232645298 GTTTGCAGGAAGTAGGAGGATGG + Intronic
948761702 2:240196419-240196441 TTATGCCTGAAGAAGCAGCACGG - Intergenic
1168857704 20:1020350-1020372 TTATGGATGAAGCAGAATGAGGG + Intergenic
1170171575 20:13419290-13419312 GTGTGCATGTAGAGGGAGGAGGG + Intronic
1173001989 20:39111473-39111495 TGGTGCAGGAAAAAGGAGGATGG + Intergenic
1173052666 20:39579375-39579397 TTATGCATATACAAGGATGAGGG - Intergenic
1174397512 20:50256961-50256983 TTATGTGAGAAGAAGCAGGAGGG - Intergenic
1178115064 21:29408395-29408417 TAATTCATGAAGAAGGACCAAGG + Intronic
1178373355 21:32046329-32046351 TTCTCCAGGAAGGAGGAGGACGG + Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1183220786 22:36511625-36511647 ATCTGCATGAAGCTGGAGGAGGG - Exonic
1184378913 22:44132873-44132895 TGCTGCAGGAGGAAGGAGGAAGG - Exonic
1185002494 22:48254413-48254435 ATATGCACAAAGAAGGAAGAGGG + Intergenic
949551631 3:5116634-5116656 ATGTGGATGGAGAAGGAGGAAGG - Intergenic
949573155 3:5312598-5312620 CTTTCCATGCAGAAGGAGGAAGG - Intergenic
951601841 3:24385448-24385470 TTGTGCATGCTGAAGGAGCAAGG + Intronic
951664154 3:25103381-25103403 TTAACCATGAAAGAGGAGGAAGG - Intergenic
954397305 3:50299537-50299559 TGACGCAAGGAGAAGGAGGAGGG - Intergenic
955573472 3:60332447-60332469 TTATGAATGAAGAACGAGCTAGG + Intronic
956384457 3:68701966-68701988 ATTTGCATGAAGGATGAGGAAGG - Intergenic
957156981 3:76556278-76556300 TTAGGCATGAAGAAATTGGAGGG + Intronic
957311301 3:78522692-78522714 TCATTCATGAAGAATGAGAAGGG + Intergenic
958116392 3:89224483-89224505 TTATTTCTGAAGAAGGAAGATGG + Intronic
958455478 3:94325913-94325935 CAAGGCAGGAAGAAGGAGGAAGG + Intergenic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
959204851 3:103293384-103293406 TTATTAAGGAAAAAGGAGGAGGG - Intergenic
959429304 3:106232919-106232941 TAATGTATGCAGCAGGAGGAAGG + Intergenic
960202722 3:114857151-114857173 CTATGCATGAAAATGGAGGATGG - Intronic
960404580 3:117244327-117244349 GTATGCATGAGGAAGGAGGAAGG - Intergenic
961242089 3:125419946-125419968 TTATGCATGTATAAGCTGGAAGG - Intergenic
961516286 3:127439416-127439438 TTAAGCAAGGAGGAGGAGGAGGG + Intergenic
961584616 3:127911623-127911645 AAATACATGATGAAGGAGGATGG + Intergenic
964029700 3:152123006-152123028 TTACGTATGAAGAAGGAAGCAGG - Intergenic
964222217 3:154359891-154359913 TTATGGATGAAGGTGGTGGAAGG + Intronic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
964821397 3:160774236-160774258 ACTTGCATGAAGAAGGAAGAAGG - Intronic
965253345 3:166370073-166370095 TTATGCATTGAGGAGGAGGAGGG - Intergenic
965376177 3:167926999-167927021 TTATTCATGTAGGAGGAAGAGGG - Intergenic
965664907 3:171082861-171082883 TTTTGATTCAAGAAGGAGGAAGG - Intronic
966354870 3:179069231-179069253 TTATTTGTTAAGAAGGAGGAGGG - Intronic
966903386 3:184503802-184503824 TGATGCAGGCAGAAGGTGGAAGG + Intronic
967389315 3:188940053-188940075 TGATGCAAGGACAAGGAGGAGGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968955594 4:3717266-3717288 TGCTGTATGAAGCAGGAGGAAGG + Intergenic
969568816 4:7996026-7996048 CTGGGCATGAAGGAGGAGGAAGG - Intronic
970209702 4:13696598-13696620 TTTTGAAGGAAGGAGGAGGATGG + Intergenic
970586289 4:17517601-17517623 CTAAGAAGGAAGAAGGAGGAAGG - Intronic
971453729 4:26823890-26823912 TTCTGTATAAAGAAGGAAGAGGG - Intergenic
971655250 4:29336006-29336028 TTATAGAAGAAAAAGGAGGAAGG - Intergenic
971841538 4:31858803-31858825 TCATGCATCTAGCAGGAGGAGGG + Intergenic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
973200705 4:47498562-47498584 TATTGCATGAAGAAGTAGGTAGG - Intronic
973808027 4:54544414-54544436 TGATGCTAGAAGGAGGAGGAAGG + Intergenic
973833706 4:54788550-54788572 TTATGCATGCATAAGGAAGAGGG + Intergenic
976081367 4:81358868-81358890 TTAGGCATAAAGAATAAGGAGGG + Intergenic
976940182 4:90690653-90690675 TTATGCATGAGGAAAGAATATGG - Intronic
977466376 4:97387043-97387065 TGATGAATGATGAAGGAGGAAGG + Intronic
977504903 4:97888945-97888967 ACATGGCTGAAGAAGGAGGAAGG - Intronic
977938239 4:102829396-102829418 CTAGGCATGAAGATGGAGGGAGG + Intronic
978157320 4:105504927-105504949 ATATGCAGCAGGAAGGAGGATGG - Intergenic
980417243 4:132507455-132507477 TTATGCATGAAGGAGAAAAAGGG + Intergenic
980794559 4:137664050-137664072 TTATGCATCTTGAAGCAGGATGG + Intergenic
981776082 4:148369147-148369169 TTTTGCATGAAGCAGAATGAGGG - Intronic
982025672 4:151251919-151251941 TTATCCATTGAGAAAGAGGATGG - Intronic
983172393 4:164551031-164551053 TTATGCAAGAGTCAGGAGGATGG + Intergenic
985219032 4:187683042-187683064 TCATGCAAGGAGAATGAGGAGGG + Intergenic
986568824 5:9144310-9144332 TTATGCCTGAAGAATGCAGAAGG + Intronic
987274699 5:16350116-16350138 TTATCTCTGAAGAAGGAGGGAGG - Intergenic
987278950 5:16392870-16392892 TTCTGCATAAAGGAGGATGAGGG + Intergenic
987368070 5:17167743-17167765 ATATGCATGAAAAAGGATGAGGG + Intronic
987841937 5:23233392-23233414 TTAAGCATGGAGAAACAGGATGG - Intergenic
988376284 5:30439698-30439720 GTCTGCGTGAAGAAGGAAGAGGG + Intergenic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
989785372 5:45321210-45321232 TTAGGGATGTAGAAAGAGGATGG + Intronic
990682413 5:58260066-58260088 TGAAGTATGAAGAAGTAGGAAGG + Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
991031619 5:62087674-62087696 TCATGCATGAGAAAGCAGGAAGG - Intergenic
991637663 5:68722493-68722515 TAATGCATGGAGGAGGAGGAAGG + Intergenic
992453228 5:76892013-76892035 TTCAGAATGAAGGAGGAGGAAGG + Intronic
993158809 5:84262296-84262318 TTATTCAAGAAGAAGGAGAAAGG + Intronic
993390139 5:87310520-87310542 CTTTGCATAAAGAAGTAGGAAGG + Intronic
993479474 5:88406350-88406372 TTCTGCATGAAAAAGGACTACGG + Intergenic
993498364 5:88634006-88634028 TTTTGCATGAAGCAGCAGCAAGG - Intergenic
994149250 5:96429757-96429779 TTCTTCATGAAGAATGTGGATGG - Intronic
994945095 5:106377539-106377561 ATATACATGAAGAAGGCTGAAGG - Intergenic
996261623 5:121477820-121477842 TTATACAAGAGGAAGAAGGAAGG - Intergenic
996771521 5:127091663-127091685 TTCTGCATGAGGTGGGAGGAGGG - Intergenic
997059894 5:130488430-130488452 TTCTGCATGCAGAAAGGGGAAGG + Intergenic
998047484 5:139000319-139000341 TTAAACATGAATAAGGATGAAGG + Intronic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998569337 5:143243448-143243470 TTATGGATGCAGAAAGTGGAGGG - Intergenic
999379442 5:151109989-151110011 TTGTGCTTGAGGAAGGAAGAGGG - Intronic
999806132 5:155083059-155083081 ATATGCATGAAACAGAAGGAAGG + Intergenic
1000280565 5:159778240-159778262 TTAGGCATCTAGTAGGAGGAAGG + Intergenic
1000704534 5:164494246-164494268 TTGTGCATAGAGAAGAAGGAAGG + Intergenic
1000971844 5:167723415-167723437 TTATGAATGAAGGAGGAGCCGGG - Intronic
1002901639 6:1414898-1414920 CCATTCATGAAGAAGAAGGAGGG - Intergenic
1003510634 6:6776998-6777020 TAATACATGAAAAAGGTGGAAGG - Intergenic
1004535496 6:16496896-16496918 ATCTGCAAGATGAAGGAGGAGGG - Intronic
1004539218 6:16533739-16533761 ATATGCGTGACGAAGGAGAATGG - Intronic
1004735005 6:18396795-18396817 TTAAGCATGAACTGGGAGGAAGG + Intronic
1005256007 6:24003750-24003772 TTATTAATGAGGAAGCAGGAAGG + Intergenic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1005365523 6:25072575-25072597 TTATGGATGAACAAGGAAAATGG - Intergenic
1006428009 6:33978153-33978175 TTATTTGTGAAGGAGGAGGAAGG + Intergenic
1006635128 6:35456460-35456482 TCCTGGAGGAAGAAGGAGGAAGG + Intronic
1007950691 6:45869598-45869620 TTTTTCAGGAAGAAGGAGCAGGG - Intergenic
1007987937 6:46225956-46225978 TTGTGTATAAAGTAGGAGGAAGG + Intronic
1008082047 6:47204870-47204892 TTAGACTTGAAGCAGGAGGAAGG - Intergenic
1008713227 6:54255155-54255177 TTATGCAGGAAAAAGAAGCAGGG - Intronic
1009334354 6:62467502-62467524 GTAAGAAAGAAGAAGGAGGAAGG + Intergenic
1009890099 6:69670243-69670265 ATATGCATGGAGAGGGAGAAAGG + Intergenic
1010686924 6:78864142-78864164 TTATGCAAAAAAAAGGGGGAGGG + Intergenic
1011753658 6:90477689-90477711 TTAGTCATGAAGAAATAGGAAGG + Intergenic
1011937541 6:92799731-92799753 GTTGGCATGAAGAAGGAGGTTGG - Intergenic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1012304741 6:97640410-97640432 TTATGCATGAATAGGGAATATGG + Intergenic
1013764526 6:113559212-113559234 TTGGGCATGAAGAAGGAAGTGGG + Intergenic
1014062130 6:117083586-117083608 TTAGGCATGAATAAGGAGCTTGG + Intergenic
1014438947 6:121451601-121451623 TGATGCATGTATATGGAGGAGGG + Intergenic
1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG + Intronic
1014789883 6:125660165-125660187 CAATACATGAAGAAGTAGGAGGG - Intergenic
1015445283 6:133296745-133296767 TGATGAATGAAAAAGGAGAAAGG - Intronic
1015903763 6:138095423-138095445 TCATGCATGAGCCAGGAGGAAGG - Intronic
1018005219 6:159615801-159615823 ATAAGAATGAGGAAGGAGGATGG + Intergenic
1018258072 6:161941923-161941945 TTATTAATGAAGCAGGAGGTGGG + Intronic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1018807752 6:167274372-167274394 TTAGGCAGGAGGAGGGAGGACGG - Intronic
1018861795 6:167715888-167715910 TCAGGCATGAAGAAGCTGGAAGG + Intergenic
1020502191 7:8937344-8937366 ATATGCATGAATAAAGAGGAGGG - Intergenic
1021884816 7:25128434-25128456 TGATGCTTGAGGAAAGAGGAGGG - Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022843747 7:34190030-34190052 TGAGGCAGGAAGAAGGAGGCTGG + Intergenic
1023314029 7:38916862-38916884 TTATACATAAAGAAAGAGTATGG + Intronic
1023412266 7:39899963-39899985 TTAGGCACCAAGAAGGGGGAAGG + Intergenic
1023628594 7:42140803-42140825 TTATACAAGAAAAAGGAGGAGGG + Intronic
1026580016 7:71607841-71607863 TTAACCATCAAGAAGGAAGAAGG - Intronic
1028743087 7:94298372-94298394 TTAAGCATGAAGAACAAGGTAGG + Intergenic
1028897319 7:96056527-96056549 TTATGTAGGAAGAATGAGCATGG - Intronic
1030115722 7:106060870-106060892 TTTTCCATGAACAAGGAGGATGG + Intergenic
1032044625 7:128594394-128594416 TCATGTATGAAGAAGGAACATGG + Intergenic
1032134702 7:129265256-129265278 ATATGAAGCAAGAAGGAGGAAGG + Intronic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032527299 7:132588565-132588587 ATATGCATGAAGAATTAGGGAGG - Intronic
1032927990 7:136630775-136630797 TTATGGATGATGAAGGAATATGG - Intergenic
1033034007 7:137854094-137854116 CTAAGCATGAAGAAGGAAAAGGG - Intergenic
1034485504 7:151358622-151358644 TTTTCCATGGACAAGGAGGAAGG - Intronic
1034721468 7:153298076-153298098 GAATGAATGAAGAAGGAGTAGGG + Intergenic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1037587934 8:20290811-20290833 TGAAGCAGGAGGAAGGAGGAAGG + Intronic
1037635509 8:20698336-20698358 TCAGGCATGAAGCAGGAAGATGG + Intergenic
1038654366 8:29435794-29435816 TTCAGCAGGAAGAAGAAGGAAGG + Intergenic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1040687394 8:49891130-49891152 TTATGCTTCCAGAAGGGGGAAGG + Intergenic
1041416071 8:57609815-57609837 TTATGCTTGAGGAAAGAAGAAGG + Intergenic
1041606978 8:59793120-59793142 CTATGCTTGAGGAAGGAGGTGGG + Intergenic
1041746367 8:61212570-61212592 TTTTGGAGGAAGAGGGAGGAAGG + Intronic
1042002769 8:64144983-64145005 GAATGCATGAAAAAGGAGCAAGG - Intergenic
1042255851 8:66802743-66802765 GTAGGAAGGAAGAAGGAGGAAGG + Intronic
1042696363 8:71558048-71558070 TTAGGGATGAAAACGGAGGAGGG - Intronic
1044431231 8:92109629-92109651 CTCTGCATATAGAAGGAGGATGG - Intergenic
1045891684 8:107165225-107165247 TTATGCTAAAAGATGGAGGATGG - Intergenic
1045911313 8:107413852-107413874 TTAGTCTTGCAGAAGGAGGATGG + Intronic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047421630 8:124712433-124712455 TCATGCTTGAAGAAGCAGGGAGG - Intronic
1048357451 8:133665135-133665157 GTTTGCATGAGGAAGGAGGCAGG + Intergenic
1048951530 8:139500876-139500898 TTGTGAATGGAGGAGGAGGAAGG + Intergenic
1050501459 9:6302457-6302479 CTGTTCATGAACAAGGAGGAAGG - Intergenic
1050668326 9:7967267-7967289 TTATGCATGAAGCAATAGGTCGG + Intergenic
1050751054 9:8937702-8937724 TTTTGTAAGAAGGAGGAGGAAGG - Intronic
1051007168 9:12359530-12359552 TTATGCATGAAGAAGTAATCAGG - Intergenic
1051605932 9:18917824-18917846 TCATCCATGGAGAAGGATGAGGG - Intergenic
1052025430 9:23568623-23568645 TTATTTATTATGAAGGAGGATGG + Intergenic
1052620706 9:30905553-30905575 TTCTTCCTGAAGAAAGAGGAAGG - Intergenic
1052968141 9:34357875-34357897 TGAAGAAGGAAGAAGGAGGAAGG - Intergenic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1055654077 9:78436380-78436402 TAAAGCATGAAGGAGGAAGATGG + Intergenic
1055791660 9:79929067-79929089 CTGGGCATGAAGAAGGAGGTGGG - Intergenic
1055957166 9:81785131-81785153 TTACTCATGAACAAGGAAGAGGG - Intergenic
1056492379 9:87120307-87120329 TTCTCTATGAAGAAGCAGGAGGG + Intergenic
1057226662 9:93296458-93296480 GGAAGGATGAAGAAGGAGGAAGG - Intronic
1058098517 9:100891173-100891195 TTAAGCATGGAGAACCAGGATGG + Intergenic
1058634242 9:107020929-107020951 TTAAGTATGAAGATGGAAGATGG + Intergenic
1062521965 9:136961671-136961693 TTCTGCAGGAGGAAGAAGGAGGG + Intergenic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1188102893 X:26112535-26112557 TAAAGCATGAAAAAGCAGGAAGG - Intergenic
1188485140 X:30674307-30674329 TTCTCCATGAAGCAGGAGGTAGG - Intronic
1189506520 X:41616537-41616559 TTATGCATGAATATGGAGGTTGG + Intronic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190280862 X:48928921-48928943 GTTTGCAGGAAGAGGGAGGAAGG + Intronic
1190577208 X:51852145-51852167 TTATGTCTGAAGATGGAGAAAGG - Intronic
1192428599 X:71097670-71097692 TTAGTCATGAAGAAGGAGGTAGG + Intronic
1192587626 X:72331930-72331952 TTAGGGATGGTGAAGGAGGAGGG - Intronic
1192721979 X:73708749-73708771 TCATGCATGAAAAGGAAGGAGGG + Intergenic
1193325997 X:80179150-80179172 TTATGCATGAGGGAGTAAGAAGG + Intergenic
1196141258 X:112265795-112265817 TTATGCATGGAGGAGGAGGAAGG - Intergenic
1196634816 X:117990259-117990281 TTATGATAGAAGAATGAGGATGG + Intronic
1198326665 X:135580576-135580598 GTTTTCATGAAGATGGAGGAAGG - Intronic
1200758247 Y:7012025-7012047 TTATGCATCAGCAAGGAGGTTGG + Intronic