ID: 1005267967

View in Genome Browser
Species Human (GRCh38)
Location 6:24132948-24132970
Sequence TAAGCAAATAAATGTATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 443}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005267967 Original CRISPR TAAGCAAATAAATGTATAGC TGG (reversed) Intronic
902259635 1:15215032-15215054 AAAGAAAATAAATGTATACAAGG - Exonic
903001219 1:20267159-20267181 TAAGTAAATAAAAGTATAGGAGG - Intergenic
904632863 1:31856074-31856096 CAAGCAAATATATGTATTTCTGG + Intergenic
904875228 1:33649703-33649725 TAAGTAAAACAAAGTATAGCAGG - Intronic
905603986 1:39280198-39280220 TAAGCAAATAAAAGTATTTTGGG - Intronic
906709573 1:47919222-47919244 GAAGTAAATAAATGTACAGATGG + Intronic
906735759 1:48125413-48125435 AAAACAAGTAAATGGATAGCAGG + Intergenic
906899082 1:49813718-49813740 TACGAAAATAAATATATAACAGG + Intronic
907030927 1:51170882-51170904 TAAATAAATAAATAAATAGCTGG + Intergenic
907077817 1:51594247-51594269 TAAATAAATAAATAAATAGCCGG + Intronic
909040937 1:70650658-70650680 TAAGCAAATATATTTATATATGG + Intergenic
909594557 1:77391342-77391364 CAGACAAATAAATGTATACCAGG - Intronic
909699150 1:78501245-78501267 TAAGCAAATAAAGCTAAAACTGG - Intronic
910287981 1:85576151-85576173 TAAACAAATCAATATATAGAAGG + Intronic
910627534 1:89324300-89324322 CAGGCAAAGAAATGTACAGCTGG - Intergenic
910733934 1:90431181-90431203 TAAGTAAATAAATGAATAGTTGG - Intergenic
910752717 1:90651482-90651504 TAAGGAAATAAATGGATTTCAGG + Intergenic
911282775 1:95952094-95952116 CAAGCATAAAAATGTTTAGCAGG - Intergenic
911702634 1:100971943-100971965 TAAGAAAATAAATGTTAACCTGG - Intronic
911896461 1:103441552-103441574 TAAGGAAAGATATGTTTAGCAGG - Intergenic
912027593 1:105197886-105197908 TAAGCAAAACAATGTAATGCTGG - Intergenic
912704287 1:111900366-111900388 TATGCAAATGAATGTTTGGCAGG - Intronic
913422814 1:118691363-118691385 TAAGCAGATAAATGTACTCCAGG - Intergenic
914934254 1:151964395-151964417 TAGGCAACTAAATGTGTAGTTGG - Intergenic
918145830 1:181754894-181754916 GAAGCATAGAAGTGTATAGCTGG - Intronic
918272622 1:182917538-182917560 TAAGAAAATAAATTTCTGGCCGG - Intronic
918754055 1:188313675-188313697 TAAGCAAATATATGCAAAGCTGG - Intergenic
919041907 1:192399759-192399781 TAAATGAATAAATGTATAGGTGG - Intergenic
919345056 1:196364671-196364693 TAAGCAAACAAATGTAAATCAGG + Intronic
919359501 1:196573405-196573427 TCAGCAATTAAATGTAGTGCTGG - Intronic
919454436 1:197804801-197804823 TAAGAAAATAAAATTATAGCTGG + Intergenic
920979698 1:210821798-210821820 TAAATAAATAAATAAATAGCTGG - Intronic
921010665 1:211137835-211137857 TAGGGAAATACATCTATAGCAGG - Intergenic
921145962 1:212356830-212356852 TAAGCAAAAAAATGTCTGGATGG - Intronic
921665024 1:217858731-217858753 TAATAAAATAAAATTATAGCCGG + Intronic
922406356 1:225317622-225317644 AAAGAAAAAAAAAGTATAGCAGG + Intronic
922789522 1:228303541-228303563 TAAGCAAATGAATATACAGATGG - Intronic
922789620 1:228304169-228304191 TAAGCAAATGAATGTACGGAAGG - Intronic
923023152 1:230181684-230181706 TAAGAAAAGAAAGGTATGGCTGG - Intronic
923054173 1:230413088-230413110 TAAGCAAAACAATGTACCGCAGG - Intronic
923371140 1:233314311-233314333 TAAGCAAGAAAATGGATGGCTGG + Intergenic
923758044 1:236811750-236811772 TAAGCAAAATGATGCATAGCAGG + Intronic
924459209 1:244243414-244243436 TAAATAAATAAATAAATAGCTGG + Intergenic
1062848350 10:725072-725094 TAAGCAAACAAAAAAATAGCTGG + Intergenic
1066399748 10:35064623-35064645 TAAGTAAATAAATGTGGAGAGGG - Intronic
1068542576 10:58312055-58312077 TAAATAAATAAATGAAAAGCTGG + Intergenic
1068939102 10:62663457-62663479 TAAGCAAATAAATCTAGTGGGGG - Intronic
1069067512 10:63959239-63959261 TGAGAAAAGAAATGTATAGTTGG + Intergenic
1069481107 10:68783162-68783184 TAAATAAATAAATATTTAGCTGG - Intronic
1070049208 10:72870576-72870598 TAAGAAAATATAGGTAAAGCTGG - Intronic
1071514133 10:86285900-86285922 TAAGCAAAACAATGTACAGCAGG - Intronic
1072179352 10:92965959-92965981 GAAGCAAATAAATCTATGTCAGG - Intronic
1072930472 10:99658325-99658347 TAAGCAAATGAATGAATGGGGGG - Intergenic
1073527155 10:104194586-104194608 TAAGAAAATAACTGTATCACCGG + Intronic
1074552336 10:114456128-114456150 TAAGCAAAACAACATATAGCAGG + Intronic
1074747151 10:116546144-116546166 AAAACAAATAAATGTTGAGCTGG + Intronic
1075556580 10:123436716-123436738 TAAGCAAGTAAATAAATAGAAGG - Intergenic
1077737951 11:4811470-4811492 TAAGCAAATTAACTTAAAGCAGG - Intronic
1078703593 11:13716272-13716294 TAAAAAAATAAGTGAATAGCTGG + Intronic
1079674865 11:23214155-23214177 TAAACACATAAATGCAAAGCTGG + Intergenic
1080359998 11:31501814-31501836 TAAATAAATAAATAAATAGCTGG + Intronic
1080981610 11:37413903-37413925 TTAAAAAATAAATGTATAGATGG + Intergenic
1080986486 11:37473153-37473175 TATTTTAATAAATGTATAGCTGG + Intergenic
1081361945 11:42190703-42190725 TAAGCAAAAAAATATTTAGTGGG + Intergenic
1083051938 11:59785222-59785244 TAAGCCAATATATTTATAGAGGG + Intronic
1085788137 11:79473062-79473084 TTAGAAAATAAATGTAGAGGAGG - Intergenic
1086508874 11:87534004-87534026 TAAGAAAGTAAATGAATAGAGGG - Intergenic
1087028586 11:93679137-93679159 TAAGCAAAGAAATCTCTTGCTGG - Intronic
1087818149 11:102681376-102681398 TAAGCAGACAAATGTGTAGAAGG + Intronic
1088059086 11:105623605-105623627 TAGGCAAATAACTGTATTGGAGG - Intronic
1088146905 11:106692026-106692048 TAAGCAATCAAATGTATACAAGG + Intronic
1088877275 11:113946365-113946387 TAAATAAATAAATAAATAGCTGG + Exonic
1089450457 11:118591894-118591916 TAAATAAATAAATAAATAGCTGG - Intronic
1090489188 11:127143100-127143122 GAAGCAAAGACATTTATAGCTGG - Intergenic
1091310320 11:134570330-134570352 TAAGCAAATAAACCTACAGAGGG + Intergenic
1091870999 12:3891252-3891274 CACGCAAATATATGTAAAGCTGG + Intergenic
1092289878 12:7153625-7153647 GAAGGAAAAAAATTTATAGCTGG - Intronic
1092673817 12:10893432-10893454 TAAGCAAATAAAAATATAGGAGG - Intronic
1093197008 12:16141562-16141584 TATGCCAATCAATGAATAGCGGG - Intergenic
1094271357 12:28620271-28620293 TAAACAAATGAAGGTATAGAGGG + Intergenic
1094384113 12:29875164-29875186 TAAGAAAATAAATGCATTGTAGG + Intergenic
1095219000 12:39586022-39586044 TAAGCACATAAGTGTAAAGATGG - Intronic
1095332762 12:40988741-40988763 TAAGCAAAGAGATATAAAGCAGG - Intronic
1096948005 12:55431664-55431686 TCAGCAAATAAATGATTAGATGG - Intergenic
1097530793 12:60797580-60797602 AAATCAATGAAATGTATAGCAGG - Intergenic
1097860311 12:64512319-64512341 AAAGCAAATAAATGATCAGCCGG + Intergenic
1100202048 12:92309475-92309497 TAAGCAAATAAATGGGGAGGGGG - Intergenic
1101286288 12:103316651-103316673 TAATCAAATAAAAATAAAGCAGG - Intronic
1102858027 12:116311825-116311847 TAAATAAATAAATAAATAGCTGG - Intergenic
1102882696 12:116497879-116497901 TAAATAAATAAATGTAAGGCTGG + Intergenic
1103353070 12:120298928-120298950 TAAATAAATAAATAAATAGCCGG + Intergenic
1104449997 12:128861218-128861240 TAAGCGTATAATAGTATAGCTGG - Intronic
1104557546 12:129814843-129814865 GTAGCAATTAAATGGATAGCAGG - Intronic
1104994685 12:132646461-132646483 TAAGTGAAGTAATGTATAGCAGG + Intronic
1106716745 13:32397634-32397656 TAAGTCAAACAATGTATAGCAGG - Intronic
1106721765 13:32441912-32441934 TAAATAAATAAATAAATAGCCGG + Intronic
1107569756 13:41644363-41644385 TTAGCAGATACATGTAGAGCAGG + Intronic
1107704018 13:43081358-43081380 TAAGCAAAATGATGTATGGCAGG - Intronic
1108209126 13:48120631-48120653 TAAGCAATTACATATGTAGCTGG + Intergenic
1108267758 13:48729710-48729732 TAAACAAATAAATATATAAATGG - Intergenic
1109691167 13:65891691-65891713 TAGGAAGATAAATGTATAGGGGG - Intergenic
1110344798 13:74433129-74433151 AAAGCAAATCAATGTTTACCAGG - Intergenic
1110829372 13:80012724-80012746 TTAACAAATAAATATATGGCTGG + Intergenic
1111238231 13:85437537-85437559 TAAACAAATTAATGTATATAGGG - Intergenic
1111609740 13:90588118-90588140 TGAGCAGATATATGTATGGCTGG - Intergenic
1111727199 13:92027437-92027459 TAACCAAAACAATGTACAGCAGG - Intronic
1111738674 13:92174617-92174639 TAAGTAAAGAAGTGTATAGGTGG - Intronic
1111758393 13:92428836-92428858 TAAACAAAAATATATATAGCTGG + Intronic
1112960171 13:105114665-105114687 TAAGTAAATAAATGAATAAATGG + Intergenic
1114159621 14:20149811-20149833 TAGCCAAATAAATGTCTTGCAGG - Intergenic
1114349125 14:21830487-21830509 TAAGTAAATAATGGTATAGATGG - Intergenic
1114904471 14:27109126-27109148 AAAACAAATAAATGTATACATGG - Intergenic
1115316875 14:32034106-32034128 TATGCAAATAAATGAATGGATGG + Intergenic
1115443306 14:33461105-33461127 TAAGTAAATAAATAAATGGCAGG - Intronic
1115669134 14:35589123-35589145 TAAGCAAAACAACATATAGCAGG + Intronic
1115679819 14:35724991-35725013 TAAATAAATAGATGAATAGCTGG - Intronic
1115829423 14:37318484-37318506 TAAGCAAATAATTGTATGATAGG - Intronic
1115925781 14:38431971-38431993 CATGGAAATGAATGTATAGCAGG - Intergenic
1116122634 14:40739995-40740017 TAAGCAACTAAATTTATATGAGG + Intergenic
1116826586 14:49678519-49678541 TAAGTAAATAAATAAATAACAGG + Intronic
1117144122 14:52819836-52819858 TAAATAAATAAATAAATAGCCGG - Intergenic
1118641943 14:67800950-67800972 TAAATAAATAAAAGTACAGCTGG + Intronic
1118664046 14:68047184-68047206 AAAGCAAAAGAATGAATAGCAGG + Intronic
1119443319 14:74644128-74644150 TAAATAAATAAATAAATAGCTGG + Intergenic
1120075571 14:80153855-80153877 TAATCAAATATATTTATGGCTGG + Intergenic
1120350029 14:83343100-83343122 TAAATAAATAAATAAATAGCTGG - Intergenic
1120749276 14:88182902-88182924 AAACCAAATAAATGTACAGTAGG + Intronic
1121968264 14:98330790-98330812 AAAAAAAAAAAATGTATAGCAGG + Intergenic
1122063381 14:99153029-99153051 TAAAGAAATAAATTTATGGCCGG - Intergenic
1122190423 14:100038286-100038308 AAAGCAAATAAATCCACAGCAGG + Intronic
1124097179 15:26659537-26659559 TAAGTAAATAAATAAATAACAGG + Intronic
1124579661 15:30942311-30942333 TAAGCAAATTAGTGGATAGGAGG - Exonic
1124850664 15:33335785-33335807 TAAACAAATACATAAATAGCAGG - Intronic
1125743270 15:41982283-41982305 TAACCAAGGAAATGTATAACCGG - Exonic
1126079714 15:44947953-44947975 TAACCAATTAAATGAAAAGCAGG + Intergenic
1126347377 15:47710395-47710417 TTAGCAAATAATTGCATAACTGG + Intronic
1126623144 15:50660372-50660394 AAAATAAATAAATGTATACCAGG + Intronic
1126954559 15:53918074-53918096 TAAGCAAATAAAATTCTGGCAGG - Intergenic
1127887091 15:63211150-63211172 TAAGCTAATAAAAGCAGAGCTGG - Intronic
1128726657 15:69992818-69992840 TTAGCAAATAAAAATATAGGAGG + Intergenic
1129423114 15:75445579-75445601 TAAATAAATAAATAAATAGCTGG + Intronic
1130110105 15:80956976-80956998 TAAATAAATAAATAAATAGCTGG - Intronic
1130740762 15:86597196-86597218 TAGGTAAATAGATGGATAGCTGG - Intronic
1131836349 15:96395494-96395516 TAAATAAATAAATAAATAGCCGG - Intergenic
1134530989 16:14983696-14983718 TAAGCAAATAATAGTATAGGTGG - Intronic
1135644653 16:24151434-24151456 TAAGCAAATAACAGTTTAGGTGG + Intronic
1135858643 16:26034819-26034841 TAAGTAAATAAATAATTAGCTGG + Intronic
1136055362 16:27684356-27684378 TAAGCAAATAATAGTTTAGTTGG - Intronic
1136355477 16:29742607-29742629 AAAGCAAATAATTGTACAGATGG + Exonic
1137756897 16:50909565-50909587 TATTAAAATAAATCTATAGCTGG + Intergenic
1137798935 16:51244933-51244955 TATGCAGATAAATGAATTGCAGG - Intergenic
1138824738 16:60305342-60305364 TAAGCAAATAATTTAATATCAGG - Intergenic
1138831538 16:60380724-60380746 TAAATAAATAAATAAATAGCCGG - Intergenic
1139755732 16:69142061-69142083 GAAACAAATAAATGAATAACAGG - Intronic
1139865360 16:70057333-70057355 TAAGCAAATAATAGTATAGGTGG + Intergenic
1139941957 16:70611851-70611873 TAAATAAATAAATAAATAGCTGG + Intronic
1140770688 16:78201465-78201487 AAACCAAATAAATGAGTAGCAGG + Intronic
1143078968 17:4367303-4367325 AAAGCAAATAAAAAAATAGCAGG - Intergenic
1144447546 17:15344870-15344892 ACATCAAATAAATGTATAGGGGG - Intergenic
1145928865 17:28669636-28669658 TTAAAAAATAAATGAATAGCCGG + Intronic
1146178443 17:30681741-30681763 TAAATAAATAAATAAATAGCCGG + Intergenic
1146222928 17:31041040-31041062 TAAATAAATAAATAAATAGCTGG + Intergenic
1146342072 17:32028971-32028993 TAAATAAATAAATGAATAGCTGG - Intronic
1146350738 17:32090624-32090646 TAAATAAATAAATGAAAAGCTGG + Intergenic
1146417750 17:32652734-32652756 CAAGCAAATACATTCATAGCAGG + Intronic
1147233774 17:39041008-39041030 TTATAAAATAAATGAATAGCTGG - Intergenic
1147281976 17:39369645-39369667 TAAGAAAATAAACACATAGCTGG - Intronic
1148130507 17:45259812-45259834 TTAAAAAATAAATTTATAGCTGG - Intronic
1148803401 17:50248645-50248667 TAAGAAAATAGATGAAAAGCTGG - Intergenic
1148995877 17:51709143-51709165 TGAGCAAGTAAATGAATAGATGG - Intronic
1149031894 17:52092961-52092983 TAAGCAAAACAACGTATAGTAGG + Intronic
1150161895 17:62905575-62905597 TAAACAAACAAATAAATAGCTGG + Intergenic
1150420980 17:65035241-65035263 TAAAAAAATACATATATAGCGGG + Intronic
1150535967 17:66041358-66041380 TAAGCAAAACAGTGTATAGCAGG + Intronic
1150779548 17:68109673-68109695 TAAATAAATAAATATATAGATGG - Intergenic
1150997317 17:70333621-70333643 TAAGTAAATAAATACATATCTGG - Intergenic
1151377438 17:73699850-73699872 TCAGCAAATAATTGTTTTGCTGG + Intergenic
1153352741 18:4098969-4098991 TAAGCAAGTAAATCCAAAGCTGG - Intronic
1154083796 18:11282389-11282411 TAAAAAAAGAAATGTATAGAGGG - Intergenic
1155187253 18:23397889-23397911 AAAGAAAATAAATAAATAGCTGG + Intronic
1155230443 18:23768868-23768890 TAAGCAAATTAATGCAAAACCGG + Intronic
1155747220 18:29371732-29371754 TTAAAAAAGAAATGTATAGCAGG - Intergenic
1156127947 18:33930802-33930824 AAAGAATATAAATGTATATCAGG + Intronic
1156363780 18:36407198-36407220 TAAACAGACAAATGTAGAGCTGG + Intronic
1157308248 18:46532813-46532835 GTAGCAAATAAATGAATAGTAGG + Intronic
1157674316 18:49557471-49557493 TAAATAAATAAATAAATAGCTGG + Intergenic
1159266627 18:66088845-66088867 TAAACAAATATATGCATAGTAGG + Intergenic
1159548293 18:69868526-69868548 TAAACAAATAAATGAATAATTGG - Intronic
1159785565 18:72710252-72710274 TAAGCATGAAAATATATAGCTGG + Intergenic
1159836876 18:73347800-73347822 AAAGAAAAGAAATGCATAGCTGG + Intergenic
1161008130 19:1946585-1946607 TAAATAAATAAATAAATAGCCGG - Intronic
1161908007 19:7171841-7171863 AAAACAAATAAAAGTATATCTGG - Intronic
1162106294 19:8371713-8371735 TAAGTAAATAAAAGTAAAGACGG - Intronic
1162980170 19:14233833-14233855 TAAATAAATAAATAAATAGCCGG - Intergenic
1163494030 19:17634260-17634282 TGAGTAAATAAATGGATAGAGGG - Intronic
1163792233 19:19314160-19314182 TAAATAAATAAATAAATAGCCGG + Intronic
1165048191 19:33123101-33123123 TAAATAAATAAATAAATAGCTGG + Intronic
1165469396 19:35994722-35994744 TAAATAAATAAATAAATAGCGGG + Intergenic
1167857460 19:52254231-52254253 TAAATAAATAAATAAATAGCTGG - Intergenic
925536895 2:4927549-4927571 AAAACAAATGAATGTATACCTGG + Intergenic
926449797 2:12988589-12988611 TAAGAAATTAAGTCTATAGCTGG + Intergenic
927948472 2:27151628-27151650 TAAGTAAATAAATAAATAGTTGG - Intronic
928694835 2:33838860-33838882 CAGGGAAATAAATGTATACCAGG - Intergenic
929642078 2:43591535-43591557 AAAGCAAGTAAATGTATTACTGG - Intronic
930804456 2:55476416-55476438 AAAGCAAAGATCTGTATAGCTGG - Intergenic
931361454 2:61581223-61581245 TAAATAAATAAATAAATAGCCGG + Intergenic
932477323 2:72014365-72014387 TAAGCAGATATATGGATAGATGG + Intergenic
933040330 2:77456872-77456894 TAATCAAAGAAATGTAGAGTTGG - Intronic
933551598 2:83784358-83784380 TAAGCAAATAAATGAATGAAAGG - Intergenic
936065716 2:109330718-109330740 TAAACAAATAAATGGAGAGATGG + Intronic
936652752 2:114448147-114448169 TAAGCTATAAAATGTAAAGCTGG - Intronic
936675584 2:114710335-114710357 CAAGCAACTTATTGTATAGCAGG - Intronic
936801425 2:116272188-116272210 TAAATAAAAACATGTATAGCTGG - Intergenic
937700841 2:124861424-124861446 TAAATAAATAAATAAATAGCTGG + Intronic
939215481 2:139232504-139232526 TAAGCACATGAATGTATAGAAGG - Intergenic
940642786 2:156364615-156364637 GAAGCAAATAAATGTCTGTCTGG + Intergenic
941048300 2:160701640-160701662 TTACCAAATAAATTAATAGCAGG - Intergenic
941254875 2:163216436-163216458 TAAAAAAATAAATGAATAACTGG - Intergenic
941789458 2:169535434-169535456 TAAATAAATAAATAAATAGCAGG - Intronic
941925622 2:170891546-170891568 ATAGCAGATAAAAGTATAGCAGG + Intergenic
942275867 2:174323286-174323308 TAAACAAATAAATAAATTGCTGG + Intergenic
942873414 2:180763801-180763823 AAAGCAAATAAATGTACACTAGG + Intergenic
942880363 2:180853788-180853810 TAATCTCATAAATATATAGCAGG - Intergenic
943260900 2:185662482-185662504 TAAGCAAAACAATGTACAGCAGG + Intergenic
943362114 2:186932103-186932125 TAAGCAAAGTAATGTATAGTAGG + Intergenic
943825981 2:192393033-192393055 TAAGCAAATAAATATCTCTCTGG - Intergenic
944837480 2:203594082-203594104 TAAGTAAATAAAAGCATGGCTGG - Intergenic
945832068 2:214799400-214799422 TAAACAAACAAATGAATAGATGG + Intronic
946522690 2:220484013-220484035 TAAGCAAATAGATGTAGTGATGG + Intergenic
946842715 2:223834593-223834615 TAAATAAATAAATAAATAGCTGG + Intronic
947196686 2:227574741-227574763 TGAATAAATAAATGTAAAGCTGG - Intergenic
947540990 2:230977971-230977993 TAAATAAATAAATAAATAGCTGG - Intergenic
948556045 2:238812095-238812117 TTAACAAATAAATGTAGACCAGG - Intergenic
1169380111 20:5098853-5098875 TAAGCACATAAATATATATCTGG - Intronic
1169412964 20:5389615-5389637 TATGCAAATAAAAAGATAGCGGG + Intergenic
1171983281 20:31642000-31642022 TAAATAAATAAATAAATAGCCGG - Intronic
1171998277 20:31750448-31750470 TAAATAAATAAATAAATAGCCGG - Intronic
1172031289 20:31983962-31983984 TAAATAAATAAATAAATAGCGGG + Intronic
1172769216 20:37368845-37368867 TAAGAAAATATAGGCATAGCCGG - Intronic
1173572803 20:44088373-44088395 TAAGCAAAAAAGTGGGTAGCTGG - Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174901859 20:54508874-54508896 TAAAAAAATAAATAAATAGCTGG - Intronic
1177606965 21:23392474-23392496 CAAGCAAAATAATGTATAGATGG - Intergenic
1177889941 21:26792922-26792944 TTAGCAAATACATGTATTTCTGG - Intergenic
1178452419 21:32715133-32715155 TAATTAAATAAATTTCTAGCTGG - Intronic
1178826504 21:36021502-36021524 TACCCAAAAAAATGTAAAGCAGG + Intergenic
1182932759 22:34190733-34190755 TTAGCAAATAAAAGTAAAGGAGG + Intergenic
1183847161 22:40551663-40551685 AAACCAAATAAATGTCTTGCCGG - Intronic
949239650 3:1855035-1855057 TAAGCAATTTAATGTATGGGCGG - Intergenic
949807543 3:7972519-7972541 CAAGCAAATTAATGCATAGCAGG - Intergenic
950733391 3:14982224-14982246 TAAGTAAGTAAATAAATAGCTGG - Intronic
951064988 3:18253761-18253783 TTAGATAATATATGTATAGCAGG - Intronic
951913535 3:27776007-27776029 TAAGCAAATAAATAAATAAAGGG + Intergenic
952112666 3:30142189-30142211 TTAGAAAATCAATGTACAGCTGG - Intergenic
952636320 3:35537161-35537183 TAAAAAAATAGATGGATAGCTGG + Intergenic
953243813 3:41172868-41172890 TAAGCAAATAATTGTCTAGGTGG - Intergenic
954168978 3:48784764-48784786 TAAGCAAAACAATGTATAGAAGG + Intronic
954208880 3:49082469-49082491 TCAGGAAATAAATGTATATTTGG - Intronic
954832530 3:53434695-53434717 TGAGCAAATAAATGCATGGGTGG + Intergenic
956033017 3:65059934-65059956 TAAGTCAAGAATTGTATAGCCGG - Intergenic
956065682 3:65395092-65395114 TAAGTGAATAAATCTATTGCAGG - Intronic
956125440 3:66006990-66007012 TAAATAAATAAATAAATAGCTGG - Intronic
956155900 3:66296402-66296424 AAAGCAAATGCATGTATATCAGG - Intronic
956653171 3:71523897-71523919 AAAGCAAAGAGATGTGTAGCAGG + Intronic
957278844 3:78124114-78124136 TATGCACATAAATGTATGGACGG - Intergenic
957627126 3:82667741-82667763 TAAGTAAATAAATGAGTGGCAGG - Intergenic
957869779 3:86076413-86076435 TAAGCAAATAAATATGTAATTGG - Intergenic
958745998 3:98135395-98135417 TAATTAAATAAAAGTATATCAGG - Intergenic
959219009 3:103491126-103491148 TAAGTAAACAAATATAGAGCAGG - Intergenic
960040386 3:113144408-113144430 TGATTAAATAAATTTATAGCTGG + Intergenic
960426468 3:117514258-117514280 TAAATAAATACATGTATAGATGG + Intergenic
960661204 3:120060896-120060918 TAAACAAATAAATAAATAGGTGG - Intronic
962451429 3:135520593-135520615 GAAAAAAATAAATGAATAGCTGG + Intergenic
963165643 3:142200187-142200209 TAAGCAAAAAAATGTAAGCCTGG - Intronic
963580159 3:147116002-147116024 TAAGTAAGAAAATGTATAGAAGG - Intergenic
963943225 3:151116150-151116172 TAAACACATAAATGTGTAGAGGG - Intronic
963984522 3:151576336-151576358 TAAGTGAATAAATAAATAGCAGG - Intergenic
964807021 3:160621345-160621367 TAAATAAATAAATAAATAGCTGG + Intergenic
965190508 3:165521818-165521840 TAAGATAATAAATATATACCAGG - Intergenic
965610590 3:170539508-170539530 TAAGTAAATAAGTGAATAGATGG - Intronic
966042920 3:175513854-175513876 TAGGCAAATAAATCTATAATAGG + Intronic
966181169 3:177189969-177189991 TAAGAAAATAAAGTTCTAGCTGG + Intronic
966689439 3:182727840-182727862 TAAATAAATAAATGGATAGATGG + Intergenic
967124192 3:186409638-186409660 TAAGCCAATAATGGTATAGGGGG + Intergenic
968014121 3:195312440-195312462 TAAACAAATAAAAATATAGAGGG - Intronic
970948055 4:21718515-21718537 TAGGTAAATAAATGTATGCCAGG + Intronic
971342234 4:25781195-25781217 TAAACAAATAAATATATAATAGG - Intronic
972765001 4:42144606-42144628 TTAGCAAATAAATGAAAAGAAGG - Intronic
972814888 4:42633408-42633430 TAAGCAAATGAATGAACAACAGG - Intronic
972927147 4:44023551-44023573 TAAGTAAAGAAATGTGTAACTGG - Intergenic
974038909 4:56841155-56841177 TATGAAAATAAATAAATAGCCGG - Intergenic
974267149 4:59600166-59600188 TAAATAAATAAATAAATAGCTGG + Intergenic
974323420 4:60382665-60382687 TATCCAAGTAAATGTATAGCAGG + Intergenic
976320759 4:83712567-83712589 TATACAAATAAATGTATATAAGG - Intergenic
976619383 4:87112738-87112760 TAAGCAAATAAATCTGAAGTGGG + Intronic
976632754 4:87255871-87255893 TAGGAGAAGAAATGTATAGCGGG - Intergenic
977860421 4:101952172-101952194 TAAGCAAAATGATGTACAGCAGG + Intronic
977907731 4:102498026-102498048 TAAGTGAATACGTGTATAGCAGG + Intergenic
978888833 4:113797342-113797364 TAAATACATAAATGTATATCTGG - Intergenic
979206448 4:118044351-118044373 TAAGCAAATAAAAATTTACCTGG - Intronic
979819193 4:125150210-125150232 TAAATAAATAAATAAATAGCAGG - Intergenic
981009411 4:139909934-139909956 TAAGAAAGTAAATGCATAGTTGG + Intronic
981564907 4:146090097-146090119 TAAGCAAACAAATGTTTAAAAGG + Intergenic
981654284 4:147094311-147094333 TAAGAAAATAAATGTTTATTTGG + Intergenic
981927587 4:150156507-150156529 TAAATAAATAAATAAATAGCCGG + Intronic
981982711 4:150814172-150814194 TAAGTAGATAAATATATAGATGG - Intronic
982592309 4:157329752-157329774 GTATCAAATAAATGTATAGTAGG - Intronic
982894539 4:160902030-160902052 TAAGCAAATATAGGTATATGTGG + Intergenic
982993285 4:162307152-162307174 TAAATAAATAAATGAATAGATGG + Intergenic
983818555 4:172164298-172164320 TAAGCAAATAATTTTAGAGATGG - Intronic
983914475 4:173277193-173277215 TAAACAAAAAAATGTGGAGCGGG + Intronic
984975087 4:185223050-185223072 CAACCAAATAGATGTATAGATGG + Intronic
985833182 5:2251013-2251035 TAATGAAATAAATATTTAGCAGG + Intergenic
986320207 5:6624910-6624932 TAAGCAAATAGCTGTTTTGCTGG + Intronic
986611289 5:9570357-9570379 ATAGCAAATAAATGTATGGTTGG + Intergenic
986612197 5:9580400-9580422 GAAGCAAACACATGAATAGCAGG - Intergenic
986694841 5:10342494-10342516 TAAATAAATAAATCTACAGCGGG - Intergenic
986886977 5:12250664-12250686 TAAACAAAGACATGTATATCAGG + Intergenic
987360380 5:17100897-17100919 TAAATAAATAAATAAATAGCTGG - Intronic
987463294 5:18241560-18241582 TGATTAAATATATGTATAGCTGG - Intergenic
987700091 5:21386398-21386420 TAAGCAAATAAAGCTAAAGGGGG + Intergenic
987854913 5:23408593-23408615 TAAGTAAATAAATGGAAAGTTGG + Intergenic
988752316 5:34201683-34201705 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
988904961 5:35777696-35777718 TAAATAAATAAATAAATAGCTGG + Intronic
989490997 5:42053364-42053386 TAAGGAAATAAATATACATCAGG + Intergenic
989719021 5:44503144-44503166 TAAGCTAATATATGTAAAGTGGG - Intergenic
989796275 5:45477784-45477806 TAAGCCAATAAAAGTATAAATGG + Intronic
989827256 5:45872421-45872443 TAAACAGATAATTGTAAAGCAGG - Intergenic
990115679 5:52387765-52387787 TAAGCAAAGAAATATTTAGGTGG - Intergenic
990745426 5:58954514-58954536 TAAGCAAAAAAAATTAAAGCTGG - Intergenic
990876483 5:60492274-60492296 GAAACAAATAAATAAATAGCTGG + Intronic
991740078 5:69662510-69662532 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
991757421 5:69890673-69890695 TAAGCAAATAAAGCTAAAGGGGG + Intergenic
991791653 5:70242251-70242273 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
991819541 5:70538627-70538649 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
991836824 5:70766555-70766577 TAAGCAAATAAAGCTAAAGGGGG + Intergenic
991884102 5:71242589-71242611 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
993321988 5:86482156-86482178 CAAGCAGATAAATGTATTGTGGG - Intergenic
993707416 5:91186819-91186841 TTTACAAATACATGTATAGCAGG - Intergenic
994079353 5:95689306-95689328 CTAGAAAATAAATGTGTAGCAGG + Intronic
994257361 5:97615036-97615058 TGAGCAAATAAATCAGTAGCAGG + Intergenic
994284326 5:97946333-97946355 TAAGCAAATAAATCTTAAGGAGG - Intergenic
994895200 5:105694442-105694464 TATTTAAATAAATATATAGCAGG + Intergenic
995825039 5:116287085-116287107 TAAGCAAAACAATGTACAGCAGG + Intronic
996211824 5:120819557-120819579 TAAGCAAATACATCTTTGGCAGG - Intergenic
996224614 5:120976526-120976548 TAAGCAAATAACTGCAAAGGTGG + Intergenic
996651639 5:125884855-125884877 TAAGAAAATAAATATATATCCGG - Intergenic
996971639 5:129376581-129376603 CAAGCAAATAAATGTTTGACTGG + Intergenic
998575787 5:143314601-143314623 TAAGCAATTAAAGGCATAGGAGG - Intronic
999567590 5:152882372-152882394 TAGAAAAATAAATATATAGCAGG + Intergenic
1000261407 5:159591942-159591964 TAAGCCAATAAATGGCAAGCGGG + Intergenic
1002019193 5:176351460-176351482 TAAGAAAATCAAAGTATAGGTGG + Intronic
1003339919 6:5210104-5210126 TAATGATATAAATATATAGCTGG + Intronic
1003545395 6:7053855-7053877 TAAGTAAATAAATGTAGACTGGG - Intergenic
1004869632 6:19891729-19891751 TAAGTCATAAAATGTATAGCTGG - Intergenic
1005267967 6:24132948-24132970 TAAGCAAATAAATGTATAGCTGG - Intronic
1005550481 6:26908406-26908428 TAAGCAAATAAAGCTAAAGGGGG - Intergenic
1005603696 6:27453816-27453838 TAAGAAAAGAAATGGAGAGCTGG + Intronic
1005636813 6:27760812-27760834 TAAGAAACAAAATGTATATCAGG + Intergenic
1006319383 6:33311328-33311350 TAAATAAATAAATAAATAGCAGG + Intronic
1007574093 6:42913740-42913762 TAAGGAAATAAATGTAAATTTGG + Intergenic
1008438016 6:51498765-51498787 TATGCAAATAAATGTCTGGTGGG - Intergenic
1008706626 6:54168386-54168408 GAAGCAAATAAATTTTTATCTGG + Intronic
1009609264 6:65918601-65918623 TAAGCAAAATGATGTAGAGCAGG - Intergenic
1009884549 6:69610282-69610304 CAATTAAATAAATGGATAGCAGG + Intergenic
1010826247 6:80479614-80479636 TATTCAAATAGATGTATAGAGGG - Intergenic
1011563571 6:88649008-88649030 TAAGCAAAGCAATGTACAGCAGG + Intronic
1011773613 6:90703180-90703202 AAAGCAAATAAATGTCTAAATGG - Intergenic
1012681492 6:102188063-102188085 TAAGCTCATAAATGTACAGGGGG + Intergenic
1012843267 6:104356593-104356615 AAAGCACATACATGTAAAGCAGG - Intergenic
1013280596 6:108632988-108633010 TAAGCAAGTAAAAGTTCAGCTGG + Intronic
1013340851 6:109214203-109214225 TAAGCAAAACAGTGTAGAGCAGG - Intergenic
1013689508 6:112624156-112624178 GAAGGAAAAAAGTGTATAGCAGG - Intergenic
1014648072 6:124000235-124000257 TAAGAAAATAGATGTATATGTGG - Intronic
1015300549 6:131648953-131648975 TAAGCAAATACATATTTAGGAGG - Intronic
1015694114 6:135960546-135960568 TAGCTAAATAAATGAATAGCAGG - Intronic
1016640581 6:146344193-146344215 TGAACAAATAAATGAATAGCAGG - Intronic
1017115315 6:150970494-150970516 TAAACAAATAAATGCATAAATGG - Intronic
1017147455 6:151247552-151247574 CAAGCAAATAAATTTAAAGATGG - Intronic
1017227316 6:152037083-152037105 TTAAGAAATAAATGTAAAGCAGG - Intronic
1017256739 6:152341865-152341887 TAAGCAAAACCATGTACAGCAGG - Intronic
1018558312 6:165073486-165073508 TCAGCAAATAAATGCATCCCTGG - Intergenic
1020149406 7:5670086-5670108 TAAATAAATAAATAAATAGCTGG - Intronic
1020632041 7:10651204-10651226 TACATAAATAAATGAATAGCAGG + Intergenic
1021065629 7:16169358-16169380 AAGGTAAACAAATGTATAGCTGG - Intronic
1022957191 7:35391828-35391850 TAAGTAAATCAAAATATAGCAGG - Intergenic
1022997414 7:35771149-35771171 TAAGCAAATAAATGCAATGTGGG + Intergenic
1024778047 7:52811314-52811336 TAAGCAAAACAATATATAGCTGG + Intergenic
1024788145 7:52931832-52931854 TATGGAAATAACTGTATAGGTGG - Intergenic
1024958580 7:54951525-54951547 TAAGCAAACAGATGTATTGGGGG + Intergenic
1027183432 7:75955309-75955331 TAAGGAAATAATAGTATAGATGG + Intronic
1027585024 7:80046571-80046593 TAAATAAATAAATAAATAGCTGG - Intergenic
1027794998 7:82681373-82681395 TGAGAAAATAAATGTACAACTGG + Intergenic
1028390311 7:90308926-90308948 TAAGCTATTAAATTTATATCAGG - Intronic
1029212472 7:98920172-98920194 TAAGAAAATAGATTTATGGCCGG + Intronic
1030241217 7:107327656-107327678 AAAGCAAATAAATAAATGGCTGG + Intronic
1031275620 7:119718500-119718522 TTAGCTAATAAAGTTATAGCAGG - Intergenic
1031654127 7:124331048-124331070 TAAACAAATAAATGTAGAAGGGG + Intergenic
1033571863 7:142637438-142637460 TCAGGAAATAAGTGTGTAGCAGG + Intergenic
1033592827 7:142827714-142827736 TAAATAAATAAATAAATAGCGGG + Intergenic
1033793073 7:144815963-144815985 TGAGCAAATAAGTGTATTACAGG + Intronic
1034211920 7:149371351-149371373 TAAGGAAATAAAAATAAAGCTGG - Intergenic
1034698794 7:153078518-153078540 TTAGCAAATAAAAATATAGGAGG + Intergenic
1035211455 7:157331449-157331471 TAAGCATATATATGTTTAACAGG + Intergenic
1037151662 8:15642884-15642906 TTAGCAAATAAATGAATAAATGG - Intronic
1038436105 8:27537519-27537541 TAAGACAATTAATGTATAGGAGG - Intronic
1038900874 8:31842267-31842289 TAAGCAAATATATGAGTAGCTGG - Intronic
1039025957 8:33258280-33258302 TAACAAAATAAATTTATTGCAGG - Intergenic
1040004171 8:42604483-42604505 TAAGCAAATGAGAGTATAGAAGG - Intergenic
1041762083 8:61378241-61378263 TAAGAAAAAAAATGTATAAAGGG - Intronic
1042335814 8:67629317-67629339 TAAATAAATAAATAAATAGCTGG + Intronic
1043004393 8:74800165-74800187 TAAGCTAATAAATTTGAAGCTGG - Intronic
1043323446 8:79019495-79019517 TAGGCAAAGAAATGTATCTCTGG - Intergenic
1043761720 8:84076641-84076663 TATGCATAAAAATGTATAACTGG - Intergenic
1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG + Intergenic
1045045686 8:98275014-98275036 GTTGCAAATAAATGTATAGGGGG + Intronic
1045110228 8:98933542-98933564 TAAGGAAATAAATGTGTAATAGG + Intronic
1045984494 8:108234028-108234050 TAAATAAATAAATATATATCAGG - Intronic
1046051478 8:109028044-109028066 TATTAAAATAAATGTATAACTGG + Intergenic
1047098354 8:121648676-121648698 TAAACAAATAAATAAAAAGCTGG - Intergenic
1048114731 8:131508943-131508965 ATAGTAAATAAATGTATACCTGG + Intergenic
1048707886 8:137174756-137174778 TTAGCAAATAATTGTATGGCTGG - Intergenic
1048760820 8:137793195-137793217 TTAGCAAATATAGTTATAGCAGG + Intergenic
1050192644 9:3044327-3044349 TAAGCAAATAAACATATAGTGGG - Intergenic
1050723501 9:8619054-8619076 TTAAAAAATAAATGTATGGCTGG - Intronic
1050891716 9:10832670-10832692 CAAGCAAAAAAATGTTTACCAGG - Intergenic
1051235259 9:14992866-14992888 TAAGTCAATAACTGTATAGTAGG + Intergenic
1052090911 9:24326328-24326350 TAAACAAATAAATGTAAACTTGG + Intergenic
1052335505 9:27315329-27315351 TAATCACATAAACGTATAACAGG - Intergenic
1052966261 9:34342862-34342884 TAAATAAATAAATAAATAGCTGG + Intronic
1053504688 9:38631495-38631517 TTAGAAATTATATGTATAGCTGG - Intergenic
1054164162 9:61704285-61704307 TGAGGAATTAAATGTATAGAGGG - Intergenic
1055176318 9:73321657-73321679 TAAGATGACAAATGTATAGCTGG - Intergenic
1055185017 9:73440824-73440846 TAAGCAAAGATTTTTATAGCAGG + Intergenic
1055330806 9:75181556-75181578 GAAACAAATAAATTTATAACTGG + Intergenic
1056621572 9:88219594-88219616 TAAGAAAATATATGTAAATCCGG - Intergenic
1056765885 9:89444098-89444120 TAGGACAATAAATGTAAAGCAGG - Intronic
1058551855 9:106123307-106123329 TAAGAACCCAAATGTATAGCTGG + Intergenic
1058923116 9:109637063-109637085 AAAGCTAGTAAATGTAAAGCTGG + Intergenic
1059365230 9:113781595-113781617 TAGGTAAATAGCTGTATAGCAGG - Intergenic
1059416454 9:114165597-114165619 TAGGCAGATAAATGTATGGATGG - Intronic
1060130497 9:121093101-121093123 TAAACAAATAAATATATGGCAGG - Intronic
1060284024 9:122233050-122233072 AAAGTAAATAAATGTGAAGCTGG - Intergenic
1060874547 9:127072472-127072494 TTATCAAATAAATGGATATCGGG - Intronic
1061335015 9:129927494-129927516 TTATAAAATAAATGTACAGCTGG - Intronic
1186042692 X:5498862-5498884 TAAATAAATAAATAAATAGCTGG - Intergenic
1186828933 X:13371003-13371025 TAAGCAAATTTATTTATTGCAGG - Intergenic
1187517274 X:19983723-19983745 TAAGTAAATACATAAATAGCTGG + Intergenic
1188694403 X:33172224-33172246 AAAGGAAATAAAAGTATGGCGGG - Intronic
1189690840 X:43615387-43615409 TAAGCAAATAGAGGGAGAGCAGG + Intergenic
1190114203 X:47615100-47615122 TATGCAAATACATATATAGTGGG - Intronic
1190136363 X:47803128-47803150 TAAGAAAGTAAAGGAATAGCCGG + Intergenic
1190567571 X:51746311-51746333 TAAGCAAAACAATGTACAGCAGG + Intergenic
1190938916 X:55021378-55021400 TGAGCAAATAAATGAATATGTGG - Intronic
1190960175 X:55239118-55239140 TAAGTAAATAAATTTTTAGAAGG + Intronic
1191677488 X:63806980-63807002 TTAGCAAATAAATATATAATGGG + Intergenic
1192193334 X:69011058-69011080 TGAGCAAATAAATGAAAAACTGG - Intergenic
1192633713 X:72797624-72797646 CAAGCAAATAAATGAAGAGGAGG - Intronic
1192647997 X:72923177-72923199 CAAGCAAATAAATGAAGAGGAGG + Intronic
1194120426 X:89956252-89956274 TAAGCAATTTAATGTATAAGTGG - Intergenic
1194142343 X:90221592-90221614 TAAATAAATAAATATATAACTGG - Intergenic
1196058564 X:111383259-111383281 CAAGGACATAAATCTATAGCTGG - Intronic
1197599700 X:128514114-128514136 TAATCAAAAAAATTTTTAGCTGG + Intergenic
1197741085 X:129894561-129894583 TAAAAAATTTAATGTATAGCTGG - Intergenic
1199137871 X:144274396-144274418 TAAATAAATTAATGTATGGCCGG + Intergenic
1199153133 X:144513741-144513763 TAAGAAAATAAATGGATTACAGG + Intergenic
1199410403 X:147515615-147515637 TAAAAAAATATGTGTATAGCAGG - Intergenic
1200322983 X:155209227-155209249 TAAACAAATAAATGAATAAAAGG - Intronic
1200337828 X:155368592-155368614 TAAATAAATAAATAAATAGCCGG - Intergenic
1200348642 X:155472635-155472657 TAAATAAATAAATAAATAGCCGG + Intergenic
1200473290 Y:3613775-3613797 TAAGCAATTTAATGTATAAGTGG - Intergenic
1200488096 Y:3790693-3790715 TAAATAAATAAATATATAACTGG - Intergenic
1200840674 Y:7778059-7778081 TATGGAAATAAATGTCTAGGAGG - Intergenic
1201927871 Y:19309404-19309426 TAAGCAAATAATTTCAGAGCAGG + Intergenic