ID: 1005268482

View in Genome Browser
Species Human (GRCh38)
Location 6:24138345-24138367
Sequence CCCCAAAATCAATCAGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005268476_1005268482 -3 Left 1005268476 6:24138325-24138347 CCCATCACCCATTGCTGCTGCCC 0: 1
1: 0
2: 4
3: 17
4: 227
Right 1005268482 6:24138345-24138367 CCCCAAAATCAATCAGGCTATGG 0: 1
1: 0
2: 0
3: 16
4: 234
1005268477_1005268482 -4 Left 1005268477 6:24138326-24138348 CCATCACCCATTGCTGCTGCCCC 0: 1
1: 0
2: 4
3: 43
4: 434
Right 1005268482 6:24138345-24138367 CCCCAAAATCAATCAGGCTATGG 0: 1
1: 0
2: 0
3: 16
4: 234
1005268475_1005268482 25 Left 1005268475 6:24138297-24138319 CCATCTATAAAAATCGATGTAAC 0: 1
1: 0
2: 0
3: 11
4: 142
Right 1005268482 6:24138345-24138367 CCCCAAAATCAATCAGGCTATGG 0: 1
1: 0
2: 0
3: 16
4: 234
1005268478_1005268482 -10 Left 1005268478 6:24138332-24138354 CCCATTGCTGCTGCCCCAAAATC 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1005268482 6:24138345-24138367 CCCCAAAATCAATCAGGCTATGG 0: 1
1: 0
2: 0
3: 16
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005268482 Original CRISPR CCCCAAAATCAATCAGGCTA TGG Intronic
900437143 1:2636271-2636293 CCCCAAAATCACTAAGCCAAAGG - Intronic
900831457 1:4968735-4968757 CCCCAAAATCACTAAGTCAAGGG - Intergenic
903699363 1:25235138-25235160 CCCCAAAATCACTAAGCCAAAGG + Intergenic
904347192 1:29880560-29880582 CCCCAAAATCACTAAGCCAAAGG + Intergenic
904449862 1:30603990-30604012 CCCCAAAATCACTAAGCCAAGGG + Intergenic
906074331 1:43041085-43041107 CACCAATAACAATGAGGCTATGG + Intergenic
906279984 1:44546489-44546511 TTCCAAATTCAATCAGGCTGGGG - Intronic
909259330 1:73467097-73467119 CCTCAAAACCAATTAGTCTAGGG + Intergenic
910203277 1:84722263-84722285 CCCCAAAATCACTAAGCCAAAGG - Intergenic
911095835 1:94054361-94054383 CCCCAAAATAAAGTAGGGTAAGG + Intronic
911130291 1:94380885-94380907 CCCCAAAATCACTAAGCCAAAGG + Intergenic
911951691 1:104181500-104181522 CCCCAAAATCACTCAGCTAAAGG + Intergenic
913510755 1:119559507-119559529 CACCAAAATCAATTAGGGCAAGG - Intergenic
915219369 1:154361955-154361977 CCCCAAAATCACTAAGCCAAGGG + Intergenic
917099353 1:171430053-171430075 CCCCAAAATCACTAAGCCAAAGG + Intergenic
919500631 1:198333778-198333800 CCCCAAAGTTACTCTGGCTATGG + Intergenic
919617026 1:199820619-199820641 CCCCCAAATCAGTCATGCTGAGG - Intergenic
919830291 1:201536191-201536213 CCCCCAAAGAAATCAGGCTGGGG + Intergenic
919869114 1:201807164-201807186 CACCAAGATCAAACAAGCTATGG + Intronic
920023974 1:202978381-202978403 CCCCAAAATCACTAAGCCAAAGG - Intergenic
921395643 1:214666316-214666338 TTCCAAAATCCTTCAGGCTATGG + Intergenic
921556782 1:216608329-216608351 CCCCAAAAGCAATGAGACCAGGG - Intronic
922217240 1:223530128-223530150 CCCCAAAATCACTAAGCCAAAGG + Intergenic
922441436 1:225658330-225658352 CTCCAAAACCATTCAGGCTATGG - Intergenic
922913234 1:229234682-229234704 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1063020133 10:2118773-2118795 CCCTAAAATCACTAAGGCAAAGG + Intergenic
1071054966 10:81499025-81499047 CCCAAAAAACAATCAGGCATGGG + Intergenic
1071234128 10:83624661-83624683 GCGCAAAATCAGTCAGACTAAGG + Intergenic
1073518932 10:104106833-104106855 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1075977547 10:126708697-126708719 CCCCAAAATCACTCAGCTAAAGG + Intergenic
1079242440 11:18729990-18730012 CCCCAAAACCAAGCTGGCTTTGG - Intronic
1080820197 11:35798370-35798392 CCCCAAAATCACTAAGCCAAAGG - Intronic
1084678473 11:70650774-70650796 CCCCAAAGTAAATCAGGAAAAGG - Intronic
1085273191 11:75282386-75282408 CACCAAAATCATCCAGGATACGG - Intronic
1086020688 11:82226211-82226233 CCCTAAAAGCAATCAGGGGAAGG + Intergenic
1087023598 11:93627995-93628017 CCCCAAAATCATTCAGCCAAAGG + Intergenic
1087145610 11:94807994-94808016 CCCCAAAATCACTAAGCCAAAGG + Intronic
1087146047 11:94812712-94812734 CCCCAAAATCACTAAGCCAAAGG - Intronic
1088469644 11:110178607-110178629 CCCCAAAATCTATCAACCTTTGG - Intronic
1089331562 11:117692435-117692457 CCCCAAACACACTCAGGATAGGG + Intronic
1090841637 11:130494282-130494304 ACAGAAAATCAATAAGGCTAAGG - Intergenic
1091178428 11:133581733-133581755 CCCCAAAATCTATGACCCTATGG + Intergenic
1092143072 12:6197398-6197420 CCCCAAAATCAATAAGCCAAAGG - Intergenic
1093057608 12:14570239-14570261 CCCCAAAATCACTAAGCCAAGGG + Intergenic
1093404031 12:18782781-18782803 CCCCAAAATCATTAAGCCAAAGG + Intergenic
1094478779 12:30863517-30863539 CCCCAAAATCATTCCTCCTAAGG + Intergenic
1094742620 12:33307189-33307211 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1094745853 12:33343392-33343414 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1095270299 12:40210851-40210873 CCCCAAAATCACTAAGGTAAGGG + Intronic
1096110287 12:49024731-49024753 CCCCAAAAAAACTCAGGCTAAGG - Intronic
1097555551 12:61133188-61133210 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1098358302 12:69631303-69631325 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1098666581 12:73170770-73170792 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1099483242 12:83195008-83195030 CTCCAAAACCAAACTGGCTATGG - Intergenic
1100480191 12:94970469-94970491 CCCCAAAATCACTAAGCCAAGGG - Intronic
1102433691 12:112903493-112903515 CCCCAAAATCACTCAGCTAAAGG - Intergenic
1102444023 12:112987496-112987518 CTCCAAAGACAATCAGGGTATGG - Intronic
1111065195 13:83081846-83081868 CCCGAAAATCACTAAGGCAAGGG - Intergenic
1112679218 13:101742690-101742712 CCCCAAAATCACTAAGTCAAAGG + Intronic
1112730390 13:102353997-102354019 CCCCAAAATCACTAAGCCAAAGG + Intronic
1113528662 13:111003181-111003203 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1117569068 14:57028097-57028119 CCCCAAAATCAGTTTGGCTAGGG + Intergenic
1119042700 14:71289485-71289507 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1119848198 14:77846572-77846594 CCCAAAAACCAGTCAGGATATGG - Intronic
1120769773 14:88366287-88366309 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1121087035 14:91154613-91154635 CCCCAAAATCACTAAGCCAAAGG - Intronic
1121760609 14:96441729-96441751 CCCCAAAATCACTAAGCCAAAGG - Intronic
1122864961 14:104599557-104599579 CCCCAAAATCCATCTGGCCTGGG + Intronic
1122949143 14:105031325-105031347 CCCCAAAATCACTAAGCCAACGG + Intergenic
1123481634 15:20638017-20638039 CTGCAAGATCAATCAGGCTCAGG + Intergenic
1123636379 15:22362348-22362370 CTGCAAGATCAATCAGGCTCAGG - Intergenic
1124127595 15:26951128-26951150 CCCCAAAATCACTAAAGCAAGGG + Intergenic
1124663990 15:31576041-31576063 CCCCAAAATCACTAAGCCAAAGG + Intronic
1125369904 15:38963442-38963464 CCCCAAAATGAATCAAGTTATGG + Intergenic
1126634701 15:50769003-50769025 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1127102111 15:55576908-55576930 CCCCAAAATCACTAAGCCAAGGG + Intronic
1127189682 15:56516220-56516242 CCCCAAAATCATTCAGGAGCAGG - Intergenic
1127229092 15:56969221-56969243 CCCCAAAATCACTAAGCCAAGGG - Intronic
1127857299 15:62962971-62962993 CCCCCAAATTAATCAGGTTCGGG - Intergenic
1129510487 15:76118118-76118140 CCGCAAAATCAAAAAGGCTGTGG - Intronic
1131443741 15:92478134-92478156 ACACAAAATCAATCAAGATAAGG - Intronic
1131529261 15:93178371-93178393 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1132407176 15:101550688-101550710 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1133730210 16:8572165-8572187 CCCCAAAAACCATCAGGATCAGG + Exonic
1133941828 16:10315873-10315895 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1134253169 16:12589163-12589185 CCCCAAACTCATTCAGCCAAAGG + Intergenic
1134279802 16:12807498-12807520 CCCCAAAATCACTAAGCCAAGGG + Intergenic
1134280550 16:12813283-12813305 CCCCAAAATCACTAAGGCAAAGG + Intergenic
1135224021 16:20639832-20639854 CCCCAAAATCACTAAGCCAAAGG + Intronic
1139022424 16:62766682-62766704 GCTCAAAATCAATAATGCTAAGG + Intergenic
1140642298 16:76990353-76990375 CCCCAAAATCTAGGAAGCTAGGG + Intergenic
1149266646 17:54934324-54934346 CCCCAAAATCACTAAGCCAAAGG - Intronic
1153829806 18:8912220-8912242 CTCCAAAATGAATAAGACTAAGG + Intergenic
1155504980 18:26524500-26524522 CCCCAAAGTCACTCAGGCTCAGG + Intronic
1157212810 18:45758633-45758655 CCCCAAAATCATTAAGCCAAAGG + Intergenic
1158222749 18:55167065-55167087 CCCCAACCTCTAGCAGGCTATGG - Intergenic
1163087783 19:14994675-14994697 CCCCAAAATCACTAAGCCAAAGG + Intronic
1164312810 19:24060970-24060992 CACAAAAATCAATGAGGGTAGGG - Intronic
1167952839 19:53041310-53041332 CCCCAAAATCACTTAGCCAAGGG - Intergenic
927832056 2:26359991-26360013 CTCTACAATCTATCAGGCTAGGG - Intronic
929497966 2:42463249-42463271 ACCCTAAACCTATCAGGCTAGGG + Intronic
933196865 2:79400370-79400392 CCCCAAAATCACTAAGCCAAAGG - Intronic
934955207 2:98611638-98611660 CCCCAAAATCACTAAGCCAAAGG - Intronic
935654500 2:105410193-105410215 CCCCAAAAGGAATCAGGCGGAGG + Intronic
936954482 2:118010782-118010804 CCCCAAAAACAATCAAGACAAGG + Intronic
937891324 2:126941107-126941129 CCCCAAAATCAGTAAGCCAAAGG + Intergenic
941405529 2:165083093-165083115 CCCCAAAATCACTAAGCCAAGGG + Intergenic
941505289 2:166336521-166336543 CCCCAAAATCGATTAAGCTGAGG + Intronic
943256401 2:185599021-185599043 CCCCAAAATCACTAAAGCAAAGG - Intergenic
944927507 2:204480008-204480030 CCCCAAAATCACTAAGTCAAAGG + Intergenic
945038576 2:205725686-205725708 ACCTAAAAGAAATCAGGCTATGG - Intronic
945965518 2:216182261-216182283 ACACAAAATCAATCTGGCAATGG - Intronic
946853442 2:223930036-223930058 CCCCCAAATAAATCAGAGTATGG + Intronic
948287474 2:236797478-236797500 TCCCAAAATTAATCTGGCTTAGG + Intergenic
1170085432 20:12526282-12526304 ACCCAAAATCACTCAGCCTAGGG + Intergenic
1175505044 20:59476582-59476604 CCCCAAAATCACTGAGCCCAAGG + Intergenic
1176363721 21:6019906-6019928 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1177360589 21:20064159-20064181 CCCCAAAATCACTAAGCCAAGGG + Intergenic
1177381992 21:20355961-20355983 CCCCAAAAGCCATCTGGATAGGG + Intergenic
1177662453 21:24103379-24103401 CCCCAAAACCAAACAGGAAAAGG + Intergenic
1178118054 21:29437398-29437420 CCCCAAAATCACTAAGCCAAAGG - Intronic
1178512482 21:33217186-33217208 CCCCAAAATCACTAAGCCAAGGG - Intergenic
1179106040 21:38401676-38401698 CTCCACAATCACTCGGGCTAGGG - Intronic
1179260052 21:39750141-39750163 CCCCAAAATCACTAAGCCAAAGG - Intronic
1179337119 21:40467829-40467851 CCCCAAAATCACTAAGCCCAAGG + Intronic
1179759797 21:43518639-43518661 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1184796389 22:46735841-46735863 CCCCAAAAGGAATCAGGCCCAGG - Intronic
949560641 3:5198761-5198783 CCCCAAAATCACTAAGCCAAAGG - Intronic
950107905 3:10399940-10399962 CCCCAAGGACATTCAGGCTAGGG + Intronic
954932425 3:54295890-54295912 CCCCAAAATCACTAAGCCAAAGG - Intronic
957752336 3:84437165-84437187 CCCCAAAGTAAGTCAGGATATGG - Intergenic
958038109 3:88193559-88193581 CCCCAAAATCACTAAGTCAAGGG + Intergenic
962038448 3:131679686-131679708 CCCCAAAATCATTCAGGAACAGG + Intronic
962833304 3:139162981-139163003 CCCCAAAATCACTAAGCCAAGGG - Intronic
963227792 3:142880049-142880071 CCCCAAAAAAAACCAAGCTATGG + Intronic
964486481 3:157190480-157190502 CCCCAAAATCACTAAGCCAAAGG + Intergenic
964773699 3:160252832-160252854 CCCCAAAATCACTAAGCCAAGGG - Intronic
966958254 3:184907503-184907525 CCCCAAAATCACTAAGCCAAAGG - Intronic
967248131 3:187509342-187509364 CCCCAAAATCACTAAGTCAAAGG - Intergenic
968442544 4:631355-631377 CCCCATAGTCACACAGGCTATGG - Intronic
969030430 4:4208361-4208383 CCCCAAAATCACTAAGCCAAAGG - Intronic
969655321 4:8494120-8494142 CCCCCAAATCACTCAGCCAAAGG + Intergenic
971631068 4:28994582-28994604 CCCCAATATCAATAATGCCAAGG - Intergenic
972305282 4:37824911-37824933 CCCCAAACTCAATCAAGATACGG + Intergenic
972581837 4:40401931-40401953 CCCCAAAAGAAATCAGGCTCTGG + Intergenic
972619953 4:40737681-40737703 CTCCAAAAACAATCAAGCTTAGG + Intergenic
974082825 4:57230583-57230605 CCCCAAAATCACTAAGCCAAGGG - Intergenic
975054182 4:69907542-69907564 CCCCAAAATTATTCAAGTTATGG + Intergenic
975310696 4:72900082-72900104 CCCCAAAATCACTAAGCCAAAGG - Intergenic
975573025 4:75837094-75837116 CCCCAAAATCACTAAGCCAAAGG + Intergenic
976231691 4:82850787-82850809 CTCCAAACTCAATTTGGCTATGG - Intronic
976813384 4:89120637-89120659 CCTGAAAATCTATCAGGGTATGG + Intergenic
977265021 4:94843812-94843834 ACCCAAAATCAAGGAGGCAAAGG - Intronic
977349032 4:95856897-95856919 CCCCAAAATCACTAAGCCAAGGG - Intergenic
977443128 4:97095585-97095607 TTTCAAAATCAACCAGGCTAGGG - Intergenic
978598648 4:110405254-110405276 CCCCAAAATCACTAAGCCAAGGG + Intronic
978773513 4:112482750-112482772 CTCCAAAGTAATTCAGGCTAAGG + Intergenic
979029959 4:115631251-115631273 CCCCAAAATCATTCAGGAGCAGG + Intergenic
980172292 4:129305072-129305094 CCCCAAACCCAATAATGCTATGG + Intergenic
980984011 4:139677979-139678001 CCCCAAAATCACTAAGCCAAGGG - Intronic
981914514 4:150019146-150019168 CCCCAAGATCAATTTGGCTTTGG - Intergenic
982008980 4:151088715-151088737 CCCCAAAATCACTAAGTCAAAGG - Intergenic
982916567 4:161217560-161217582 ACCCACAATCAATGAGGGTATGG - Intergenic
983583696 4:169334180-169334202 CCCCAAAATCACTAAGCCAAGGG + Intergenic
984518372 4:180770158-180770180 CCCCAAAATCATTAAGCCAAAGG - Intergenic
985080747 4:186261683-186261705 CCCCAATATCAATAATGCCAGGG + Intergenic
986637018 5:9833346-9833368 CCCCAAAATCACTAAGCCAAGGG - Intergenic
989204678 5:38798780-38798802 CCCCAAAATCACTAAGCCAAAGG - Intergenic
989446623 5:41537279-41537301 TCTCTAAATCACTCAGGCTATGG - Intergenic
991043270 5:62196898-62196920 CCCCAAAATCACTAAGCCAAAGG - Intergenic
991157958 5:63460346-63460368 TACCAAAATGAATCAAGCTAAGG + Intergenic
991161030 5:63503162-63503184 CCCCAAAATCATTCAGGAGCAGG + Intergenic
993733005 5:91445050-91445072 CCCCAAAATCACTAAGCCAAAGG + Intergenic
996955316 5:129176402-129176424 CCCCAAAATCAGTAAGCCAAAGG + Intergenic
998567193 5:143226111-143226133 CCCCTAAAAGATTCAGGCTATGG - Exonic
999004754 5:147963130-147963152 CCACAAAATCAATCAGGTTTGGG + Intergenic
999476332 5:151902350-151902372 CCCCAGAACCAATCACGGTACGG + Intronic
999726356 5:154441503-154441525 CACCAAAATCACTAAGGCAAAGG + Intergenic
999997662 5:157107570-157107592 CCCCAAACTCATTCAGTCAAAGG + Intronic
1000793427 5:165634702-165634724 CCCCAAAATCATTAAGCCAAGGG - Intergenic
1002403605 5:179010868-179010890 CCCCAAAATCACTCAGCTAAAGG + Intergenic
1002659183 5:180778985-180779007 CCCCAAAATCACTAAGCCGAAGG + Intergenic
1002848132 6:967192-967214 CCCCAAAGTATATCAGGCTTTGG + Intergenic
1002887440 6:1310135-1310157 CCCCAAATGAAATCAGGGTAAGG + Intergenic
1003386580 6:5673143-5673165 CCCCAAATTCCTTCAGGGTAGGG - Intronic
1004332192 6:14732094-14732116 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1005268482 6:24138345-24138367 CCCCAAAATCAATCAGGCTATGG + Intronic
1006965706 6:37982296-37982318 CCCCAAAATCACTAAGCCAAAGG - Intronic
1007884424 6:45210145-45210167 CCCCAAAATCACTAAGCCAAAGG + Intronic
1009704124 6:67222780-67222802 CCCCAAAATCAATCAAGATTGGG - Intergenic
1009824097 6:68844626-68844648 ACCCAAAAGTAATCAGGATATGG + Intronic
1011102796 6:83743321-83743343 CCCCAAATTCAATAATGCTGTGG + Intergenic
1012166704 6:95963037-95963059 CCCCCAAATCACTAAGGCAAAGG - Intergenic
1013343226 6:109235917-109235939 CCCAAAAATCAATCGTGCCAAGG - Intergenic
1013474077 6:110491551-110491573 CCCCAAAAGCTCTGAGGCTAGGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1014046075 6:116888775-116888797 CCCTAAAATAAATCTTGCTAGGG - Intronic
1014602171 6:123427004-123427026 CCCCAAAGACAATAAGCCTAAGG - Intronic
1014930799 6:127333321-127333343 CCCCAAAATCACTAAGCCAAGGG - Intronic
1016211430 6:141539481-141539503 CCCCAAAATCACTAAGTCAAAGG + Intergenic
1017042642 6:150319847-150319869 CCCCAAAATCACTAAGCCCAAGG - Intergenic
1021911977 7:25395237-25395259 CCCCAGAGTCAATGAGTCTATGG + Intergenic
1022702869 7:32777878-32777900 CCCCAAAAACAATGACGTTAGGG + Intergenic
1023216367 7:37867381-37867403 CCCCAAAATCACTAAGCCAAAGG - Intronic
1023278799 7:38548447-38548469 CCCCAAAATCACTAAGCCAAGGG - Intronic
1023934085 7:44726816-44726838 CCCCAAAATCATTAAGCCAAGGG - Intergenic
1026057945 7:67001325-67001347 CCCCAAAATCAACTATGATATGG - Intronic
1026720153 7:72823713-72823735 CCCCAAAATCAACTATGATATGG + Intronic
1026864309 7:73813627-73813649 CCCCAAACTCACTTATGCTAGGG - Intronic
1032144539 7:129367162-129367184 CCCCAAAATCACTAAGCCAAAGG - Intronic
1032266823 7:130375259-130375281 CCCCAAAACAAATCAAGCCATGG - Intergenic
1032607433 7:133370685-133370707 CCCCAAAATCACTAAGCCAAAGG - Intronic
1035220518 7:157403705-157403727 CCCCAAAATCACTCAGCTAAAGG - Intronic
1038009681 8:23465135-23465157 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1040913547 8:52545147-52545169 CCCCAAAATCACTAAGCCAAGGG + Intronic
1040997825 8:53419693-53419715 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1041399877 8:57430899-57430921 CTCCAAAAACAAAAAGGCTAGGG - Intergenic
1042662401 8:71169472-71169494 CCAAAAAATCAATAGGGCTATGG - Intergenic
1047136118 8:122080205-122080227 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1047312782 8:123706495-123706517 CCCCACATTCAATCAGACTAAGG + Intronic
1047570799 8:126096754-126096776 CACAAAGATCATTCAGGCTAGGG - Intergenic
1048909080 8:139117026-139117048 CCCCAATATCTATCTGGCTTAGG - Intergenic
1055603669 9:77946450-77946472 CCCCAAAAACACCCAGGCAAAGG + Intronic
1055964123 9:81848759-81848781 GCCAAAAATAAATCAGTCTATGG + Intergenic
1057467101 9:95324107-95324129 CCCCAAAATCACTAAGGTAAAGG - Intergenic
1057476343 9:95406046-95406068 CCCCAAAGTCAAACAGGTTGGGG + Intergenic
1057909588 9:99007363-99007385 CCCCAAAATCACTAAGCCAAAGG - Intronic
1058131607 9:101260030-101260052 CCCCAAAATCACTAAGCCAAAGG - Intronic
1060165275 9:121408560-121408582 CCCCAAAATCAGTAAGCCAAAGG + Intergenic
1185773707 X:2785537-2785559 CCCCAAAATCATTAAGCCAAGGG - Intronic
1185804919 X:3048216-3048238 CCCCAAAATCACTAAGCCAAGGG + Intronic
1187687992 X:21835266-21835288 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1189085153 X:38015001-38015023 CCCCAAAATCACTAAGCCGAAGG - Intronic
1194196597 X:90902491-90902513 CCCCAAACTCAATAATGCTGTGG + Intergenic
1194234322 X:91363085-91363107 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1194541025 X:95172609-95172631 CCCCAAAATCACTCAGCCAAAGG + Intergenic
1195647794 X:107252373-107252395 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1196242916 X:113365153-113365175 CCCCAAACTCAATAAGACTTTGG + Intergenic
1196590940 X:117484690-117484712 CCCCAAGCTCAATAATGCTATGG + Intergenic
1196884910 X:120235215-120235237 CCCCAAAATCACTAAGCCAAAGG + Intergenic
1197042545 X:121957128-121957150 CCCCAAAATCACTAAGGTGAAGG + Intergenic
1197565367 X:128077574-128077596 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1197945350 X:131832472-131832494 CCCCAAAATCACTAAGCCAAAGG - Intergenic
1198648396 X:138834915-138834937 CCCCAAAGTCATTCAGGATCAGG + Intronic
1198952400 X:142086608-142086630 CCCCAAAATCACTAAGGCAAAGG + Intergenic
1199249519 X:145644126-145644148 CCCTTAAATCAATGGGGCTATGG + Intergenic
1199710130 X:150463052-150463074 GCCCAAAATCACACAGGCAAAGG - Intronic
1199746868 X:150777362-150777384 CCCCAAAATCACTAAGCCAAGGG - Intronic
1200285053 X:154813000-154813022 CCCCAAAATCACTAAGCCAAAGG - Intronic
1200542443 Y:4476692-4476714 CCCCAAACTCAATAATGCTGTGG + Intergenic
1200811431 Y:7489479-7489501 CCCAAAAGTCAGTCAGGCTGAGG - Intergenic