ID: 1005271964

View in Genome Browser
Species Human (GRCh38)
Location 6:24175531-24175553
Sequence GTCATGGCCTGTGTGGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005271964_1005271969 13 Left 1005271964 6:24175531-24175553 CCCCAAACCACACAGGCCATGAC 0: 1
1: 0
2: 1
3: 19
4: 213
Right 1005271969 6:24175567-24175589 AAATTATATATATATATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005271964 Original CRISPR GTCATGGCCTGTGTGGTTTG GGG (reversed) Intronic
900203755 1:1422283-1422305 GGCAGGGTCTGTGTGGCTTGGGG - Intergenic
901008734 1:6185789-6185811 GTCATGGCCTAAGTGGCATGAGG + Exonic
901206986 1:7503086-7503108 GTCATGGGCTCTGTGGAATGGGG + Intronic
902436238 1:16399613-16399635 ATAATGACCTGAGTGGTTTGGGG + Intronic
904392830 1:30197071-30197093 GGCTTGGCCTGTGTGGTTGCAGG - Intergenic
904441669 1:30535813-30535835 TCCAAGGCCTGTGTGGTTGGAGG + Intergenic
907461813 1:54609693-54609715 GCATTGGCCTGTGTGGGTTGGGG - Exonic
907749655 1:57250207-57250229 GCCATGGACCATGTGGTTTGTGG + Intronic
907957345 1:59242454-59242476 GTCATGGCCAGTGTGGAAAGTGG - Intergenic
910423361 1:87094298-87094320 TTCCTAGCCTGTGTAGTTTGGGG + Intronic
911298480 1:96146595-96146617 GCCATGTCCTGCGTGGTATGGGG + Intergenic
911559396 1:99385386-99385408 CTCAGGGCCGGTGTGGGTTGAGG - Intergenic
912734578 1:112139112-112139134 CTCATGTCCAGTGTGGGTTGAGG + Intergenic
912778522 1:112522755-112522777 GTCAGGGCCCTTGTGGTCTGCGG + Intronic
914750352 1:150530843-150530865 GTTATGGACAGTGTGGTTTCTGG - Intergenic
915204959 1:154263254-154263276 GCCATGGCCTGCGTGGCTTGGGG + Intronic
915294629 1:154911317-154911339 GTCTTGGGCTGTGTGATTTGAGG + Intergenic
915317267 1:155035977-155035999 GTCTTGGGCTGTGCGATTTGAGG + Intronic
919801145 1:201355257-201355279 CTCCTTGCCTGTGTGGTTTTAGG - Intergenic
921312120 1:213854963-213854985 GTTCTGGCCTGTTTGGTTTCTGG + Intergenic
923545890 1:234923066-234923088 ATCATGGCCCGTGTTGTTGGAGG + Intergenic
924631267 1:245743031-245743053 CTCGGGGCCTCTGTGGTTTGTGG + Intergenic
1063256961 10:4339202-4339224 AAGATGGCCTATGTGGTTTGGGG + Intergenic
1063664316 10:8052219-8052241 TTCTTGGTCTGGGTGGTTTGAGG - Intergenic
1063665256 10:8056806-8056828 GACCAGGCCTGTGTAGTTTGAGG + Intronic
1063924024 10:10959765-10959787 GTCATTTCCTGTGGGGTATGGGG - Intergenic
1063974847 10:11406891-11406913 GGCGTGGCCTGTGTGGGATGGGG + Intergenic
1067527249 10:47046296-47046318 GTCATGGCCTGCATGGGTTTGGG - Intergenic
1067950212 10:50728408-50728430 GTCATTGACAGTGTGGTTTCAGG + Intergenic
1070885539 10:79893612-79893634 GTCATTGACAGTGTGGTTTCAGG + Intergenic
1071170402 10:82857420-82857442 CTGATGGCCTGTCTGGTGTGAGG + Intronic
1073612824 10:104961107-104961129 GTCATTGCCTTTGTGATTTTAGG + Intronic
1074366191 10:112859313-112859335 GTCATGACCTTTGCGGTTTATGG + Intergenic
1075176054 10:120162310-120162332 GGCAAGGCCTGTGTGGGCTGAGG + Intergenic
1075641053 10:124064833-124064855 GGCAGGGCCAGTGTGGTCTGGGG - Intronic
1076148575 10:128144771-128144793 GGCAGGGCCTCTGTGGGTTGAGG + Intergenic
1076758417 10:132587426-132587448 GGCATGGCCTGTGTGATTCGAGG + Intronic
1076796035 10:132798948-132798970 GACAGGGCCTGTGTGGGGTGTGG + Intergenic
1077905157 11:6526976-6526998 GTGATGCCATGTGTGTTTTGAGG + Intronic
1078182906 11:9027491-9027513 GTAATTGCCTGGGTAGTTTGGGG + Exonic
1080771190 11:35343483-35343505 GTCATGCCCAGTGGGGTTTGCGG - Intronic
1083386734 11:62316599-62316621 TTCATGGCCTTTGTGTTTGGGGG + Intergenic
1083856249 11:65394426-65394448 GTGAGGGCCTGTGTGACTTGAGG + Intronic
1084598996 11:70133776-70133798 GGCTGAGCCTGTGTGGTTTGCGG + Intronic
1086211193 11:84321538-84321560 TTCAAGGCCTGTATGGTTGGAGG - Intronic
1086676179 11:89609798-89609820 GTCTTGGCTTGTTTGCTTTGGGG + Intergenic
1087984255 11:104657927-104657949 CTTAAAGCCTGTGTGGTTTGTGG + Intergenic
1089308965 11:117545350-117545372 GTCATGGCAGGTGTGGTTTCTGG - Intronic
1089659437 11:119976313-119976335 GTCATTCACTGTGTGGTCTGGGG + Intergenic
1090091329 11:123701093-123701115 GTCCTGAACTGTGTGGTTTGAGG + Intergenic
1090649761 11:128796036-128796058 GTTATGAGCTGTGTGGTCTGAGG - Intronic
1090800713 11:130170087-130170109 GTCCTGGTGTGTGTGTTTTGGGG + Intronic
1091774996 12:3178793-3178815 GCCCTTGGCTGTGTGGTTTGAGG + Intronic
1094488786 12:30945712-30945734 GTCATGGGCTGTGAGACTTGGGG - Intronic
1094545430 12:31400079-31400101 GTCACTGTCTGTGTTGTTTGTGG - Intronic
1098763081 12:74449408-74449430 GTAATGTCCTTTGTGGTTAGAGG - Intergenic
1102394106 12:112573759-112573781 GCAATGGCCTCTGTGATTTGGGG + Intronic
1102910625 12:116711184-116711206 GTCCTGTCCTGTGGGGATTGGGG - Exonic
1103172875 12:118836609-118836631 GTCATTTACTGTGTGGTCTGGGG + Intergenic
1103606988 12:122094293-122094315 GTGATGGTGTGTGTGGTGTGTGG + Intronic
1105646598 13:22325831-22325853 TTCATGGGCTGTGTGGTATAGGG + Intergenic
1110976892 13:81849114-81849136 GTAATGGCCTGTGAGGGGTGGGG - Intergenic
1113415606 13:110126175-110126197 GTCATGGGTTGGGTGGTCTGGGG - Intergenic
1114598135 14:23931807-23931829 TCCATGGACTGTGGGGTTTGCGG - Intergenic
1116437939 14:44914737-44914759 GTCATGGGCTGTGTAGCTTTGGG + Intergenic
1120428738 14:84386785-84386807 GTCCTGGCCTATTTGGTTTCTGG - Intergenic
1121649821 14:95549709-95549731 ATCATGGCCTGTGTTCTTTCTGG - Intergenic
1121812530 14:96903963-96903985 GTGATGCCCTGTGTGGTTCTGGG + Intronic
1121892975 14:97614897-97614919 TTCCTGGCCTGTATGGTTTCTGG + Intergenic
1122830082 14:104391592-104391614 GTCCTGGACTGTGCTGTTTGGGG - Intergenic
1122898935 14:104774156-104774178 GTGATGGGGTGTGTGGTGTGGGG - Intronic
1126346199 15:47696723-47696745 GTCACTGCCTGTGTGATTTAGGG - Intronic
1129114482 15:73357671-73357693 GTCATGGCCTCCGTGGATGGAGG - Intronic
1130091310 15:80823573-80823595 GTGATGGCGTGGGTGGTTTGAGG - Intronic
1132468591 16:89346-89368 GTCATGGCCAGTGTGGCTTGAGG - Intronic
1132702969 16:1229822-1229844 GTCAGGGCCTGGGTGGGTTCTGG - Intronic
1132705354 16:1241046-1241068 GTCAGGGCCTGGGTGGGTTCTGG + Intronic
1135843897 16:25901044-25901066 GTAATGACCTGTGTGGTATTAGG + Intronic
1136186525 16:28591729-28591751 GTCCTGCCCTGTGTCGTTGGGGG - Exonic
1136189013 16:28604460-28604482 GTCCTGCCCTGTGTCGTTGGTGG - Intergenic
1137249075 16:46729870-46729892 GGAATGGCCTGGGTGGTGTGGGG - Intronic
1138601206 16:58055714-58055736 GGCCTGGCCTTTCTGGTTTGAGG + Intergenic
1139433392 16:66923243-66923265 GTCCTGGCCTGGCTGGTTGGGGG - Intronic
1140954010 16:79845862-79845884 GTCATTGCCTGTGTGACTTTGGG - Intergenic
1141787689 16:86212837-86212859 GCCATGGTCTGTGTGGTGTCGGG - Intergenic
1141787697 16:86212866-86212888 GCCATGGTCTGTGTGGTGTACGG - Intergenic
1141787714 16:86212952-86212974 GCCATGGTCTGTGTGGTGTAGGG - Intergenic
1141787734 16:86213038-86213060 GCCACGGTCTGTGTGGTGTGAGG - Intergenic
1141787773 16:86213212-86213234 GCCACGGTCTGTGTGGTATGGGG - Intergenic
1142025750 16:87812607-87812629 GTCATGGCCAGAGAGGTTTCTGG + Intergenic
1145871660 17:28278429-28278451 GTCTTTTCCTTTGTGGTTTGTGG - Intergenic
1145994557 17:29097951-29097973 ATCATGGTCTGTGTGGTTCGGGG - Intronic
1147166757 17:38597615-38597637 GTCATTTGCTGTGTGGTTTGGGG - Intronic
1151832032 17:76558658-76558680 GTCTTTGCCCGTGTGATTTGGGG + Intergenic
1154168602 18:12034839-12034861 GACATGGCTTGTGGTGTTTGGGG - Intergenic
1156453329 18:37279038-37279060 GTCAGGGGCTGTGTGGATGGAGG - Intronic
1157345651 18:46829332-46829354 TTAATGGCCTTGGTGGTTTGGGG - Intronic
1160515344 18:79476403-79476425 GTTTTGGCTTGTGTGGTCTGTGG + Intronic
1161740249 19:6016874-6016896 GTTAAAGCCTGTGTGGTGTGTGG - Intronic
1163513834 19:17751358-17751380 CCCATGGCCTGTGTGGTTCCAGG + Intronic
1163578137 19:18122618-18122640 GGCCTGGCCCCTGTGGTTTGTGG - Intronic
1164882205 19:31741807-31741829 GTGATTGCCTGTGTAGTGTGAGG + Intergenic
1165252824 19:34554338-34554360 GTCATTGCAGGTGAGGTTTGGGG + Intergenic
1165395492 19:35561455-35561477 GTCATGGTCTGTGTCCTCTGTGG + Intronic
1165707625 19:37987720-37987742 GTCATGGCCACTTTAGTTTGGGG + Intronic
1165901757 19:39172602-39172624 GTCCTGCCCTGAGGGGTTTGGGG - Intronic
1166283589 19:41810456-41810478 GCCTTGTCCTGTGTGTTTTGGGG - Intronic
1167096079 19:47375715-47375737 GCCATGGGCTGTGGGGTGTGGGG + Intronic
929670951 2:43876125-43876147 TTCATGGACTGTGTGGGCTGAGG - Intronic
930606389 2:53497421-53497443 GTCATGGCCTGTGTACTTTTAGG + Intergenic
933366164 2:81357109-81357131 GTCATGGACTGTGGGGAGTGGGG - Intergenic
937955362 2:127418983-127419005 GGCCAGGCCTGTGTGGTTTTAGG - Intronic
940139116 2:150474011-150474033 GCCCTGGCCTGTGTGCTGTGGGG - Intronic
940981251 2:160006168-160006190 GGCATGGTGTGTGTGGTGTGTGG - Intronic
943565210 2:189508887-189508909 GTCATGTCTTATGTGGTTGGTGG - Intergenic
944048469 2:195439904-195439926 CTCAGGGCCTGTGTGGGCTGAGG - Intergenic
946616780 2:221518377-221518399 GTCATGAACTGTGTGTTTTGAGG + Intronic
948368641 2:237474222-237474244 GTCATGGGGTGTGTGGTTTCTGG - Intergenic
948667062 2:239542735-239542757 GTCATCTCCTGGGTGGTTTCTGG + Intergenic
1169193359 20:3671146-3671168 GTCATGGTCTGCGGGGATTGGGG + Exonic
1169331890 20:4722803-4722825 GTCTTTGCCTGTGTGGATTAGGG - Intronic
1169939051 20:10917235-10917257 GTCATGGGCTGTATGATTTTAGG - Intergenic
1172020130 20:31908258-31908280 GTCATGGGGACTGTGGTTTGAGG + Intronic
1173325318 20:42027547-42027569 TTCACTGCCTGTGTTGTTTGGGG - Intergenic
1174156237 20:48517307-48517329 GCCTGAGCCTGTGTGGTTTGAGG - Intergenic
1174212873 20:48893839-48893861 TTCTTGGACTTTGTGGTTTGGGG - Intergenic
1178534133 21:33398589-33398611 CTCATTGGCTGTGTGATTTGGGG + Intergenic
1181279606 22:21709757-21709779 GTCATGGCCTGTGAGGATGGGGG + Intronic
1181318681 22:21988273-21988295 GTGATGGCGTGAGTGGTTTCTGG + Intergenic
1181538768 22:23561933-23561955 ACCATGGCCTGTGTGGGTTGCGG - Intergenic
1182335060 22:29578528-29578550 CTTCTGGCCTGTGAGGTTTGGGG - Intronic
1183188233 22:36304755-36304777 ATGATGGCCTCTTTGGTTTGGGG - Intronic
1185086651 22:48744469-48744491 GCCATGACCCGTGTGGTTCGTGG + Intronic
1185138467 22:49087190-49087212 GTGTGTGCCTGTGTGGTTTGTGG - Intergenic
1185332839 22:50259357-50259379 GGCCTGGCCTCTGTGGTATGGGG + Intronic
949947218 3:9200092-9200114 GGCATCGCCTGTGTGCTTGGAGG + Intronic
951068328 3:18295110-18295132 TTCAGGGCCTGTGAGGGTTGAGG - Intronic
951555371 3:23916484-23916506 GTCATGGAGTGGGTGGATTGCGG - Exonic
951668218 3:25150448-25150470 CTCATGGTCTGAGTGCTTTGGGG + Intergenic
952847668 3:37701895-37701917 CAGATGGCCTGTGTGGTTGGAGG - Intronic
952855651 3:37768804-37768826 GTCATCCCCAGTGTGGTTTTTGG - Intronic
955485998 3:59435328-59435350 GTCAAGGGCTGTGAGATTTGAGG + Intergenic
955961345 3:64344271-64344293 ATCTTGTCATGTGTGGTTTGGGG - Intronic
956900475 3:73710501-73710523 GTCATGGGCTTTGTGTTCTGTGG + Intergenic
957171025 3:76736378-76736400 GTCCTAGTTTGTGTGGTTTGGGG + Intronic
960354405 3:116633430-116633452 GACATGGCCTGTGTGATTATGGG - Intronic
964124854 3:153225697-153225719 ATCCTGCTCTGTGTGGTTTGGGG - Intergenic
964987443 3:162761830-162761852 GGCATGGCATGTGTGGTTCATGG + Intergenic
967089774 3:186125649-186125671 GTGATGGTATGTGTGGTGTGGGG + Intronic
967089828 3:186126017-186126039 GTGATGGTATGTGTGGTGTGGGG + Intronic
967089861 3:186126244-186126266 GTGATGGTATGTGTGGTGTGGGG + Intronic
968049344 3:195643413-195643435 GCCTGAGCCTGTGTGGTTTGAGG + Intergenic
968098058 3:195946211-195946233 GCCTGAGCCTGTGTGGTTTGAGG - Intergenic
968106563 3:196005727-196005749 GCCTGAGCCTGTGTGGTTTGAGG - Intergenic
968305273 3:197646519-197646541 GCCTGAGCCTGTGTGGTTTGAGG - Intergenic
968527847 4:1073225-1073247 GAGATGGCCTGTGTGGGCTGAGG + Intronic
969255904 4:6001614-6001636 ATCAGAGCCTGTGTGGGTTGAGG - Intergenic
969406095 4:6992979-6993001 CTCATAGCCTGTGTATTTTGAGG + Intronic
971356048 4:25896178-25896200 TTCATTGGCTGTGTGATTTGGGG - Intronic
972792545 4:42387017-42387039 GTCTAGGTCTGTGTGGATTGTGG + Intergenic
976139341 4:81974354-81974376 GTGATACCCTGGGTGGTTTGGGG - Intronic
976320864 4:83713652-83713674 GTCATGACTTGTGTGGTATGGGG + Intergenic
978281581 4:107022516-107022538 CTCATGAGCTGTGTGGCTTGAGG + Intronic
981051042 4:140309813-140309835 GCCATGAGCTGTGGGGTTTGGGG - Intronic
982081311 4:151793078-151793100 GCCAGGTCCTGTTTGGTTTGGGG + Intergenic
982294265 4:153810599-153810621 AGCATAGCCTGTGTGGCTTGTGG + Intergenic
984003350 4:174278703-174278725 GCAATGGCCTTTGTGGTTAGTGG - Intronic
984975665 4:185228089-185228111 GTCCATGCCAGTGTGGTTTGGGG + Intronic
985505905 5:280253-280275 GCCTGAGCCTGTGTGGTTTGAGG + Intronic
985723854 5:1505504-1505526 TTCATGCCCCGTGTTGTTTGGGG - Intronic
985742292 5:1625673-1625695 GCCTGAGCCTGTGTGGTTTGAGG - Intergenic
986732767 5:10647667-10647689 GGAATTGGCTGTGTGGTTTGGGG + Intronic
989615912 5:43336383-43336405 GTGATGGGGTGAGTGGTTTGGGG + Intergenic
992518880 5:77526664-77526686 GTCATAGCTTGTGTGTATTGGGG - Intronic
995117684 5:108500388-108500410 CTCAGGGCCTGTGAGGTTAGGGG - Intergenic
998552978 5:143094769-143094791 GTGATGGGGTGAGTGGTTTGGGG + Intronic
1000298488 5:159933933-159933955 GTGGGGGCCTGTGTGGATTGAGG + Intronic
1002774938 6:320623-320645 GTCATGGGCTGGGAGATTTGGGG + Intronic
1003406568 6:5831408-5831430 GCCAGTGCTTGTGTGGTTTGAGG - Intergenic
1005271964 6:24175531-24175553 GTCATGGCCTGTGTGGTTTGGGG - Intronic
1006544648 6:34769822-34769844 GTTATGGCCTGTGATTTTTGTGG + Intronic
1006962040 6:37942081-37942103 GTAATGGGCTGTGTGCTTTAGGG + Intronic
1009061329 6:58400755-58400777 GTCCTGGGCTGTGTGACTTGGGG - Intergenic
1009248999 6:61275307-61275329 GTCCTGGGCTGTGTGACTTGGGG - Intergenic
1009957588 6:70474065-70474087 GTCAAAGCCTGTGTGGAGTGAGG - Intronic
1010012184 6:71060994-71061016 ATAAATGCCTGTGTGGTTTGTGG - Intergenic
1011176815 6:84571184-84571206 ATAATGGCCTGTGGGGTCTGAGG + Intergenic
1016221100 6:141670577-141670599 GTCCTGGCCTGTTAGGTTTCTGG - Intergenic
1019257736 7:62514-62536 GTCAGTGCCTGTGTGTTTCGTGG - Intergenic
1019659453 7:2215862-2215884 GTGAGGGCCTGTGTGGTGTGCGG - Intronic
1020998207 7:15291919-15291941 GACATGACCTGTGTAGATTGTGG + Intronic
1024204962 7:47150077-47150099 GCCATTACCTGTGTGGTTTTAGG - Intergenic
1025233058 7:57215668-57215690 GCCTGAGCCTGTGTGGTTTGAGG + Intergenic
1029020876 7:97363905-97363927 CTCAGGGCCTGTGAGGGTTGAGG - Intergenic
1029878662 7:103781665-103781687 ATCAGGGGCTGGGTGGTTTGGGG - Intronic
1030188513 7:106787914-106787936 ATAACGGCCTGTGGGGTTTGTGG + Intergenic
1032952963 7:136937862-136937884 ATCATGGACTGTGTGTTTGGTGG - Intronic
1034741507 7:153478407-153478429 CTCAGGGCCTGTGTGGGTTGAGG - Intergenic
1035635138 8:1138735-1138757 GTCCTGGCCTGTGCGGCTGGTGG + Intergenic
1035635151 8:1138829-1138851 GTCCTGGCCTGTGCGGCTGGTGG + Intergenic
1035635159 8:1138876-1138898 GTCCTGGCCTGTGCGGCTGGTGG + Intergenic
1035635168 8:1138923-1138945 GTCCTGGCCTGTGCGGCTGGTGG + Intergenic
1036781137 8:11648646-11648668 GTCGTGGCCTGTGAGGATGGTGG + Intergenic
1037959126 8:23083420-23083442 GTCATGTGCTGTTTGGCTTGGGG - Intergenic
1038974330 8:32676220-32676242 GGGATGGCCTCAGTGGTTTGGGG + Intronic
1039429505 8:37514880-37514902 GTGATGGCCTGTGTGGCGTGGGG - Intergenic
1040139539 8:43894324-43894346 GTCCTGGGCTGTGTGAGTTGTGG - Intergenic
1045237108 8:100362126-100362148 GTTATGGCCTGTGTAGTATCTGG + Intronic
1045411852 8:101927849-101927871 GTCAGGGCCTGGGTGGAATGTGG + Intronic
1046046936 8:108975729-108975751 ATCCTGGCCTGTGTGTTTGGTGG + Intergenic
1046467688 8:114627938-114627960 TTCATGTCCTGTGTGGTGTTGGG + Intergenic
1046689067 8:117262462-117262484 GTCCTGTCCCGTGTGGTTAGTGG - Intergenic
1046974472 8:120258514-120258536 GTCTTGGTCTTTATGGTTTGGGG - Intronic
1047294250 8:123557198-123557220 GTCATGGCGTTTGTGGTCTAGGG + Intergenic
1047335361 8:123930818-123930840 GTCTTGGTCTTTGTAGTTTGAGG + Intronic
1047958846 8:129996272-129996294 GCCGTGGCCTGTGGGGTGTGAGG - Intronic
1050544790 9:6700736-6700758 AACAAGGCCAGTGTGGTTTGAGG + Intergenic
1051097024 9:13477701-13477723 CTCAGGGTCTGTGGGGTTTGTGG + Intergenic
1057039457 9:91836859-91836881 GACAGGGCTTGTGTGATTTGAGG - Intronic
1057309267 9:93931610-93931632 GTCCTGGTCTGTGTGGTGTTTGG + Intergenic
1061799974 9:133108542-133108564 GTCCCTGCCTGTGTGGTCTGAGG + Intronic
1187305685 X:18093415-18093437 CTCAGGGCCTGTGAGGATTGTGG + Intergenic
1188101613 X:26094898-26094920 TTCATGGGCTATGTGTTTTGTGG + Intergenic
1188393850 X:29655877-29655899 GTTTTGGGGTGTGTGGTTTGGGG - Intronic
1188554123 X:31392493-31392515 GTCAGGGGATCTGTGGTTTGGGG - Intronic
1188729552 X:33630432-33630454 CTCAGGGCCTGTGAGGGTTGAGG - Intergenic
1189384021 X:40521903-40521925 CTCAGGGCCTGTCTGTTTTGGGG + Intergenic
1189436540 X:40997877-40997899 GTCATGGGGTGGGTGGGTTGGGG + Intergenic
1191200665 X:57777965-57777987 GTCATGGGCTGGGGGGCTTGGGG - Intergenic
1192538418 X:71948264-71948286 GTCTTGGCCTGTGTGGCTTTGGG + Intergenic
1197011073 X:121564354-121564376 GTAATGGCCAGTATGGTTGGAGG + Intergenic
1198019564 X:132644800-132644822 TTCAGGGCCTGTGTAGTTTAGGG - Intronic
1198656482 X:138919089-138919111 GTCATTTCCTTTATGGTTTGTGG - Intronic
1199798965 X:151230716-151230738 GTGAGGGCCAGTGTGGCTTGTGG - Intergenic