ID: 1005273824

View in Genome Browser
Species Human (GRCh38)
Location 6:24195273-24195295
Sequence CAATTCCCACAATGAGAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005273816_1005273824 3 Left 1005273816 6:24195247-24195269 CCAAAATAGCATTTGCACCCAAG 0: 1
1: 0
2: 1
3: 12
4: 138
Right 1005273824 6:24195273-24195295 CAATTCCCACAATGAGAAGGGGG 0: 1
1: 0
2: 0
3: 9
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005273824 Original CRISPR CAATTCCCACAATGAGAAGG GGG Intronic
901010379 1:6198267-6198289 CAACTCCCTTCATGAGAAGGTGG - Intronic
903284642 1:22268943-22268965 CAATGACCACAATCAGATGGTGG - Intergenic
903870432 1:26430253-26430275 CTATTCCCACTAAGGGAAGGAGG + Intergenic
905549539 1:38825178-38825200 GAATTCCTGCAGTGAGAAGGGGG + Intergenic
913583774 1:120253071-120253093 AAATTCCCACAATTAGCAAGTGG + Intergenic
913624399 1:120645249-120645271 AAATTCCCACAATTAGCAAGTGG - Intergenic
914565762 1:148864907-148864929 AAATTCCCACAATTAGCAAGTGG + Intronic
914607063 1:149265345-149265367 AAATTCCCACAATTAGCAAGTGG - Intergenic
917569487 1:176250484-176250506 TAATACCCAGACTGAGAAGGTGG - Intergenic
920651455 1:207840401-207840423 CGATGCCCACAGTGGGAAGGGGG - Intergenic
923419266 1:233796600-233796622 CAGTTTCCACAATGAGAAATGGG + Intergenic
1063298526 10:4830749-4830771 CTTTTACCACAATGAGAGGGAGG + Exonic
1067070112 10:43124998-43125020 CAATTCCCACAAGCTGAAAGTGG + Intronic
1068895668 10:62197518-62197540 AAATTCTCACAATGAGAATATGG + Exonic
1069515492 10:69073750-69073772 CAGTTCCCACAAAGTGAAGATGG - Intergenic
1069548155 10:69343481-69343503 CAATTCTCAGAGAGAGAAGGAGG + Intronic
1071476427 10:86029203-86029225 CATTTGCTACAATGACAAGGAGG - Intronic
1073387164 10:103135248-103135270 CAATTCCCACATGGTGTAGGAGG + Intronic
1077050918 11:566395-566417 CCAGCCCCACAATGGGAAGGAGG + Intergenic
1079084342 11:17434260-17434282 CAAGCCCCAGAATGTGAAGGAGG - Intronic
1080450814 11:32377471-32377493 CAATTCAGACAAAGGGAAGGTGG + Intergenic
1083297873 11:61724939-61724961 AAATGGCCACAAGGAGAAGGAGG - Intronic
1088541709 11:110920287-110920309 GAATTCCCACTATTAGAATGTGG - Intergenic
1088593981 11:111426180-111426202 GTCTTCCCACAATGAGAAAGTGG + Intronic
1089847500 11:121470018-121470040 TGATTCCCACAATCAGATGGTGG + Exonic
1090235882 11:125146790-125146812 CAAGTCCCATAGTGAGAAGATGG - Intergenic
1093901332 12:24637510-24637532 AAATTCACATAATGAGCAGGTGG + Intergenic
1100853730 12:98739928-98739950 CAATGGCCATAAGGAGAAGGAGG - Intronic
1101051520 12:100868686-100868708 CAACTCCCACAAGGGGGAGGAGG - Intronic
1102202103 12:111064285-111064307 GAAATCCCACAATTAGCAGGTGG - Intronic
1103244903 12:119448361-119448383 AAAGTCACACTATGAGAAGGTGG - Intronic
1107482609 13:40797225-40797247 CATTTCCAACAGGGAGAAGGGGG - Intronic
1109672821 13:65632464-65632486 CAACTACCACAATGACCAGGTGG + Intergenic
1110277141 13:73653083-73653105 CATTTCCCACTCTGAGAGGGGGG - Intergenic
1110843223 13:80166310-80166332 TAATTTCCACAGTGGGAAGGTGG - Intergenic
1111662295 13:91226296-91226318 CATTTCCCAGAATAAGAATGAGG + Intergenic
1113097888 13:106685451-106685473 CAACTCCGACAATAAGAAGTGGG + Intergenic
1115951684 14:38728429-38728451 CAAGACCCGCAATGAGAAGCTGG + Intergenic
1115953211 14:38745050-38745072 TACTTCCCTCAATGAGAATGTGG - Intergenic
1116095153 14:40358559-40358581 CAATTCCCACATGTAGTAGGAGG + Intergenic
1117367957 14:55050279-55050301 CAATTCTCACACTGAAAAAGGGG - Intergenic
1120349047 14:83329303-83329325 CCATTCAGACAATGAGATGGGGG + Intergenic
1121432072 14:93894466-93894488 AATTTCCCAAAATGAAAAGGAGG - Intergenic
1122614445 14:103007537-103007559 GACTTCCCAAAATGAGGAGGTGG + Intronic
1125869531 15:43086501-43086523 CAATTCCTGCTATGTGAAGGTGG + Intronic
1129385481 15:75193919-75193941 CATCTCTCACAATGGGAAGGGGG + Intergenic
1130091746 15:80826989-80827011 CAAGTCCTACAATAAGAAGCAGG + Intronic
1133511621 16:6463817-6463839 CAATCCCCACTGTTAGAAGGAGG + Intronic
1133863956 16:9624402-9624424 TAATTCCCAAAATGAGATTGGGG - Intergenic
1138111728 16:54329610-54329632 CAATTCCTACAGTGTGAAGAAGG - Intergenic
1141323918 16:83037781-83037803 CAAGTCACACAATGAGTAAGTGG - Intronic
1141604841 16:85146856-85146878 GAATTCCAAGAATGAGAACGAGG + Intergenic
1143642520 17:8207225-8207247 CAAGTCCCAGATAGAGAAGGAGG - Exonic
1151250741 17:72832537-72832559 CAATTACCACACTGAAAAGTGGG + Intronic
1153979504 18:10297159-10297181 CAATCCTCCCAATGAGAAAGAGG + Intergenic
1157179247 18:45481101-45481123 CAATCCCCAAAATTAGGAGGAGG + Intronic
1158558380 18:58493502-58493524 CAATGCCCACAAGCAGATGGAGG - Intronic
1158829685 18:61263746-61263768 AAATTGCCACAGAGAGAAGGAGG + Intergenic
1167629695 19:50617923-50617945 CAATACCCAAAAGGTGAAGGAGG + Intergenic
1167719961 19:51172514-51172536 CAGTTTCCACAAGAAGAAGGCGG + Intergenic
927650933 2:24913331-24913353 CAATTCCCATGGGGAGAAGGGGG + Intronic
928043531 2:27903576-27903598 CATATCCCCTAATGAGAAGGGGG - Intronic
929526726 2:42710700-42710722 TAATTCCCAAAATGGGAAAGTGG - Intronic
929920620 2:46168838-46168860 CAAGACCCAAGATGAGAAGGGGG - Intronic
931165832 2:59746783-59746805 AAATCCCCACAAAGAGAAGAGGG + Intergenic
936554203 2:113478876-113478898 CAGTTTCCAAACTGAGAAGGAGG - Intronic
939057219 2:137380302-137380324 CAATTCTCCCAATGAGTAGCTGG - Intronic
939713167 2:145549013-145549035 CAATTCCCACATTGAGTGGAAGG + Intergenic
940365699 2:152846304-152846326 CTATTCCCAAGATGAGAATGAGG - Intergenic
941462029 2:165783041-165783063 CATCTCCCACAATGAAAAGCTGG - Intronic
942417895 2:175777871-175777893 AAACTCCCCCAATGAGAATGAGG - Intergenic
943471478 2:188299513-188299535 TATTTCCCAGAATGAGAAGGGGG - Intronic
943657592 2:190526128-190526150 CAAGTCCCAAAATGGCAAGGAGG + Intronic
944028507 2:195202271-195202293 CAAATTCCACAAGGAGAGGGTGG + Intergenic
944891917 2:204126786-204126808 CATTTCCCACAATAGTAAGGTGG + Intergenic
945267464 2:207904728-207904750 TAATTCAAATAATGAGAAGGGGG + Intronic
946141994 2:217699186-217699208 CAAATTCCTTAATGAGAAGGGGG + Intronic
1169000591 20:2165081-2165103 AATTCCCCACAATGAGGAGGAGG + Intronic
1169267645 20:4176394-4176416 CCATTCCTCCCATGAGAAGGTGG - Intronic
1169913629 20:10667021-10667043 TAATTGCCACATTAAGAAGGGGG + Intronic
1170463829 20:16604735-16604757 CATTTGCTAAAATGAGAAGGAGG - Intergenic
1176172698 20:63703373-63703395 CACTTCCCACAGTGGAAAGGAGG + Intronic
1177483406 21:21723180-21723202 CAAGGCCCACAAAGAGAAGTTGG - Intergenic
1179164704 21:38926259-38926281 CACTTCCCACAAGGAGAAGCAGG - Intergenic
1179427124 21:41290454-41290476 CCATTCCCACTGTGAGAAGGAGG + Intergenic
1180871255 22:19148598-19148620 CAATGTCCACATTGAGAAGAGGG + Exonic
1182160227 22:28114238-28114260 CACTTCTCCCAATGAGGAGGAGG - Intronic
1183539162 22:38419601-38419623 CAGTGCCCACAGTGAGAAGGAGG - Intergenic
1184747674 22:46465473-46465495 CAGTCCCCAGAATGAGAGGGAGG - Intronic
951342296 3:21503002-21503024 CAATTTCCACATTGATAAGAGGG + Intronic
952192499 3:31038708-31038730 CATTTCCCACACTCTGAAGGTGG + Intergenic
953514497 3:43576950-43576972 CAATTCCATCACTGGGAAGGAGG - Exonic
954322995 3:49844589-49844611 CAATACCCACAATAAGCAGCAGG + Intronic
955465759 3:59235765-59235787 CAATTCCCCCCCTGAGAAGCTGG - Intergenic
956654684 3:71537362-71537384 CAATACCCACACTGAGCTGGGGG - Intronic
957606911 3:82411850-82411872 CATTTCTCAAAATGAGAGGGGGG - Intergenic
958536641 3:95412279-95412301 CAGTTTTCACAGTGAGAAGGAGG - Intergenic
960055971 3:113276615-113276637 CAATCCCCAGCAAGAGAAGGGGG - Intronic
961411782 3:126727409-126727431 CAATTCCCACATGGAGAAAGTGG - Intronic
962120481 3:132555453-132555475 TAATCACCACAATGAGAAAGAGG + Intergenic
962941672 3:140130239-140130261 CCATTCCCACAAGGCAAAGGAGG - Intronic
964116196 3:153138551-153138573 CTATTCCCATCATGACAAGGAGG - Intergenic
964316490 3:155450021-155450043 CAGTTCCCACAATGAGCAATTGG - Intronic
965202578 3:165678270-165678292 CAATTCCCAAAATGTCATGGCGG + Intergenic
965455753 3:168897640-168897662 CAATCCCCACAATTTGAGGGAGG - Intergenic
965685374 3:171296571-171296593 CAAATCTCATAATGAGAAGGTGG - Intronic
966756538 3:183376580-183376602 CCATTCCTACAGTGAGAAGGGGG - Intronic
966793639 3:183694893-183694915 CATTTGCCCCAATGAGTAGGTGG - Intergenic
967242375 3:187453207-187453229 GAATTCCCACAGTGATTAGGTGG + Intergenic
969838763 4:9865051-9865073 CAAATCACACATTAAGAAGGAGG + Intronic
971471646 4:27032788-27032810 CAAATCCCAGAAAGAGCAGGAGG - Intergenic
975834276 4:78405265-78405287 AAATTTCCACAATGAAAATGTGG - Intronic
977345583 4:95812250-95812272 CCTTTCCCACAGTGGGAAGGTGG - Intergenic
987846931 5:23299229-23299251 CAAGTGCAATAATGAGAAGGAGG - Intergenic
989238571 5:39177415-39177437 CATTTTGCAAAATGAGAAGGTGG + Intronic
989606104 5:43245937-43245959 CATGTCCCAGGATGAGAAGGTGG + Exonic
990915187 5:60895675-60895697 CAATTTGCACAATGATATGGGGG + Intronic
995194531 5:109349062-109349084 CATTTCCCAGAATGAGCAGATGG - Intronic
996278260 5:121695099-121695121 TGATGCCTACAATGAGAAGGTGG - Intergenic
998886083 5:146695345-146695367 CAATACCTATAATGAGAAGTGGG - Intronic
1000950692 5:167478635-167478657 CCATTCCATCAATGAGAAGCTGG + Intronic
1001234399 5:170017319-170017341 CAAAACTCACAAGGAGAAGGAGG + Intronic
1001412582 5:171521259-171521281 CTCCTCCCACAGTGAGAAGGTGG - Intergenic
1003445759 6:6182696-6182718 CACTGCTGACAATGAGAAGGTGG + Intronic
1003498480 6:6685037-6685059 TAAGTTTCACAATGAGAAGGTGG + Intergenic
1004343535 6:14828164-14828186 CATTTCCCACAGCAAGAAGGAGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1004989801 6:21124656-21124678 CAATGGCCACAAAGAGAACGAGG + Intronic
1005002242 6:21253581-21253603 CAAGTGGCACAAAGAGAAGGGGG + Intergenic
1005273824 6:24195273-24195295 CAATTCCCACAATGAGAAGGGGG + Intronic
1008267526 6:49447924-49447946 CAAATCCCAATCTGAGAAGGGGG + Intronic
1008735644 6:54540434-54540456 CAAATCCCACAAGTAGAAGATGG - Intergenic
1010042690 6:71405257-71405279 CAATTCTCAAAGTGAGAGGGTGG - Intergenic
1010490483 6:76470367-76470389 CAATTCCCACAATAAGAATTAGG + Intergenic
1014437697 6:121438452-121438474 CAATTCCTGCATAGAGAAGGAGG + Intronic
1016930481 6:149402586-149402608 CTCTTCCAAAAATGAGAAGGGGG + Intronic
1017381663 6:153838304-153838326 CACATCCCAGAATGACAAGGAGG + Intergenic
1018323222 6:162635313-162635335 AAATACCCAGAATGAGAAAGAGG - Intronic
1021118312 7:16768706-16768728 CAGTTTTCAAAATGAGAAGGTGG + Intronic
1021925966 7:25533871-25533893 TAATTTCCACAATCAGAAAGTGG - Intergenic
1022122348 7:27321700-27321722 GAATTCCCCCAAAGAGAAGCTGG - Intergenic
1023300652 7:38767054-38767076 CAATTCCCACAATGCAACAGAGG - Intronic
1028082194 7:86591508-86591530 CTATTTTCAAAATGAGAAGGTGG - Intergenic
1031518028 7:122725553-122725575 CATTTCTCAAAATGAGAGGGTGG - Intronic
1032516291 7:132508633-132508655 CCATGCCCACCATGAGGAGGTGG + Exonic
1032665195 7:134029186-134029208 GAACTCCCACAGTGAGGAGGAGG - Intronic
1032787914 7:135215514-135215536 CCATCCCCAAAATGAGAAGGTGG + Intergenic
1033154097 7:138942113-138942135 CAAGTCCCACAACTAGCAGGTGG + Intronic
1033171241 7:139086404-139086426 CAGTACCCACAATTAGAGGGTGG - Intronic
1033506092 7:142001902-142001924 TGATTTCCACAATAAGAAGGTGG + Intronic
1034268997 7:149794627-149794649 CAATTCACACCAAGGGAAGGAGG + Intergenic
1037187787 8:16085281-16085303 CATTTTCCAATATGAGAAGGAGG + Intergenic
1037190915 8:16124204-16124226 GCATTCCCACAGTGAGAATGGGG + Intronic
1037735529 8:21562768-21562790 CAATTCCCTAATTGGGAAGGAGG + Intergenic
1037764338 8:21762858-21762880 AAATTCCCACAATGATGAGTTGG + Intronic
1040688492 8:49906505-49906527 GAATTCCAATAATGAGAAGTAGG + Intergenic
1041454455 8:58042871-58042893 CTATTCCCACAGTGTGAAGTGGG - Intronic
1044957351 8:97494949-97494971 CATTTCTCACAATTAGAATGCGG - Intergenic
1046032315 8:108797828-108797850 CAAATCCCAGAGTGGGAAGGAGG + Intergenic
1048521452 8:135159177-135159199 CAATTCCAGCAATTATAAGGTGG + Intergenic
1049898800 9:138302-138324 CAGTTTCCAAACTGAGAAGGAGG + Intronic
1050953855 9:11629989-11630011 TAATTCCCACATTGTGAGGGAGG + Intergenic
1053741853 9:41148614-41148636 CAGTTTCCAAACTGAGAAGGAGG + Intronic
1054347115 9:63978422-63978444 CAGTTTCCAAACTGAGAAGGAGG + Intergenic
1054444847 9:65304762-65304784 CAGTTTCCAAACTGAGAAGGAGG + Intergenic
1054485424 9:65716744-65716766 CAGTTTCCAAACTGAGAAGGAGG - Intronic
1054686490 9:68282686-68282708 CAGTTTCCAAACTGAGAAGGAGG - Intronic
1054752081 9:68917607-68917629 CCATTCCCTCAAAGAGAAAGAGG + Exonic
1055355578 9:75433966-75433988 CAAATCACACAATTAGTAGGAGG + Intergenic
1055770811 9:79715405-79715427 CAGTTCAGACAAGGAGAAGGTGG - Intronic
1058295049 9:103295636-103295658 CCTTCCCCACAATGAGAAGAAGG + Intergenic
1058420656 9:104830115-104830137 TAGTTCCCACAATGAGAACTTGG + Intronic
1058555009 9:106157982-106158004 CAAATACCACAAGGGGAAGGGGG - Intergenic
1059484569 9:114616944-114616966 AAATTCCCAGGAGGAGAAGGAGG - Intronic
1185540427 X:898974-898996 CAGTTCCCTCAAAGAGCAGGGGG - Intergenic
1187122893 X:16426394-16426416 CCAATCCCACAAAGAGAAGAAGG + Intergenic
1187583748 X:20637496-20637518 CCATGCCCACAGTGAGTAGGTGG + Intergenic
1191624801 X:63258947-63258969 CAATTTACACAATGAGGATGAGG - Intergenic
1193490931 X:82146404-82146426 CAATATCCACAAGGAGAAGAGGG + Intergenic
1195866488 X:109438485-109438507 CTATTCCAAAAATGAGAAGTAGG + Intronic
1198710120 X:139492256-139492278 AAATTCCCACAAATAGAAGTTGG - Intergenic
1198758271 X:140003474-140003496 AAATGCCCACATTGAGAAAGTGG + Intergenic
1202177666 Y:22112651-22112673 ACACTTCCACAATGAGAAGGTGG + Intergenic
1202213695 Y:22473744-22473766 ACACTTCCACAATGAGAAGGTGG - Intergenic