ID: 1005275825

View in Genome Browser
Species Human (GRCh38)
Location 6:24216342-24216364
Sequence TAGGCTGTCAAGGAAGATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005275825 Original CRISPR TAGGCTGTCAAGGAAGATGC GGG Intronic
900839780 1:5038953-5038975 AAGGGTGCCAAGGAAGATGTGGG - Intergenic
905119205 1:35668812-35668834 TATGCTGCCAAGAAAGTTGCAGG + Intergenic
906383718 1:45349126-45349148 AAGGCTGGCAAGGAAGAGGGAGG - Intronic
907625940 1:56029464-56029486 TAGGCTGTAAAGGGAAATACAGG - Intergenic
908236782 1:62154886-62154908 TAGGCATTCTAGCAAGATGCAGG - Intronic
908623230 1:66009030-66009052 TTGGCTGTCAAGAAGGCTGCTGG - Intronic
914243452 1:145868281-145868303 TTGGCTGTCAGGGATGGTGCTGG - Intronic
922187921 1:223292869-223292891 TAGCCTTTCAAGGAAGTTACAGG + Intronic
922616175 1:226962457-226962479 TTGACTGTCAGGGAAGCTGCTGG - Intronic
923290492 1:232540409-232540431 GAGGCTGTCATGGCAGAGGCTGG - Intronic
924003694 1:239583037-239583059 TTGGGTGACAAGGAAGATGGTGG - Intronic
1064486212 10:15793598-15793620 TAGCCTTTCAAGAAAGATACTGG + Intronic
1073061125 10:100734528-100734550 GAGGCTATCAAGGAAAGTGCTGG - Intergenic
1074498013 10:113996886-113996908 TAGGGTGTCAGGGAAGAGCCTGG - Intergenic
1076904102 10:133353768-133353790 GAGGCTGCCAAGGGAGAAGCTGG - Intergenic
1077221654 11:1420664-1420686 TAGGCAGTGGAGGAAGAGGCTGG - Intronic
1077395698 11:2320055-2320077 TAGGCTGGGAAGGAAAGTGCCGG + Intergenic
1079717069 11:23761421-23761443 TAGGCTCTGAAGGAGAATGCAGG + Intergenic
1079896553 11:26126566-26126588 TAGCCTTTCATGGAAGATACTGG + Intergenic
1080654770 11:34250166-34250188 AAGGCTGGCAAGGTAGATGGAGG + Intronic
1084945311 11:72634981-72635003 CAGGCTGTCAGGGAAGGGGCGGG + Intronic
1087775272 11:102251114-102251136 TGGGCTGTCCAGCAAGAGGCTGG + Intergenic
1088570582 11:111219626-111219648 TAGGCTGGCAGGGAGGAAGCAGG + Intergenic
1089663294 11:119999763-119999785 TAGATTGTAAAGGAGGATGCTGG + Intergenic
1090057037 11:123432230-123432252 GAGGCTGAGAAGGAAGATGAGGG + Intronic
1090856513 11:130613483-130613505 TAGCCTCCCAAGGAAGAAGCTGG - Intergenic
1091804990 12:3349515-3349537 GAGGCTGACATGGAAGAAGCAGG - Intergenic
1093249735 12:16787561-16787583 TAAGCTGTCATTGAAGATGTGGG + Intergenic
1095990095 12:48028591-48028613 TGGCCTGTCAAGGATGATGGGGG + Intergenic
1096973693 12:55686316-55686338 TAGGATGTCGAGGGAGAAGCAGG + Intronic
1097238003 12:57552761-57552783 CAGGATGTCTAGGAAGGTGCGGG + Intronic
1097591053 12:61575901-61575923 GAGGCTGTGAAGTAAGATTCTGG + Intergenic
1100455610 12:94748772-94748794 TAGGCAGGCAAGGGAGATGAGGG - Intergenic
1100918147 12:99451437-99451459 AAAGCTGTCATGGAAGAGGCAGG + Intronic
1101743002 12:107515700-107515722 ATGGCTGTCAAGGGAGAGGCAGG + Intronic
1102165628 12:110804271-110804293 TCAGCTGTCAAGGAGGAGGCTGG - Intergenic
1106431841 13:29688154-29688176 TTGCCTGCCAGGGAAGATGCTGG + Intergenic
1106620581 13:31367300-31367322 TAGCCTTTCCAGGAAGATACTGG - Intergenic
1111960924 13:94809386-94809408 TAAACAGTCCAGGAAGATGCCGG + Intergenic
1112098166 13:96158243-96158265 GAGGCTGTAGAGGGAGATGCGGG + Intronic
1112941298 13:104865898-104865920 AAGGCTGACATGGAAGATGCAGG + Intergenic
1114655506 14:24313129-24313151 AAGGCCATCAAGGTAGATGCGGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120162578 14:81161663-81161685 TAGCCTGTCATGTAAGATCCTGG - Intergenic
1122649265 14:103216724-103216746 TGGGCTGTCAGGGAAAAGGCTGG - Intergenic
1122905531 14:104800065-104800087 GAGGCTTTCAAGGAAGAAGGAGG + Intergenic
1123777380 15:23593374-23593396 GAGACTGTCATGGAAGATGTGGG - Intronic
1131047700 15:89326613-89326635 CAGGGTGTCCAGGAAGGTGCTGG + Exonic
1131907792 15:97163216-97163238 TCAGCTGTCAAGGAAGAGGCAGG - Intergenic
1132662233 16:1066632-1066654 TAGGGTGTCTGGGAAGAGGCTGG - Intergenic
1138748562 16:59391883-59391905 AAGGCAGTGAAAGAAGATGCTGG + Intergenic
1140674697 16:77316478-77316500 CAGGATGTCAAGGAAGAGGGTGG - Intronic
1142269338 16:89080945-89080967 TAGGCAGTAAAGGAAGACGCAGG + Intergenic
1144432831 17:15210853-15210875 TGGGCTGTGTAGGAAGATGATGG + Intergenic
1147625074 17:41894941-41894963 AAGGCTGTGATGGAAGAGGCAGG - Intronic
1148065058 17:44862967-44862989 CTTGCTGTCAAGGAAGATGGCGG - Intronic
1149106609 17:52975023-52975045 AAGTCTTTCAAGGAAGAGGCTGG + Intergenic
1150290483 17:63978636-63978658 TATGATGTCAAGGAAAATACAGG - Intergenic
1150437795 17:65167616-65167638 GATGGTGACAAGGAAGATGCTGG - Intronic
1152241870 17:79165158-79165180 AGGGCTGTGCAGGAAGATGCTGG - Intronic
1152301337 17:79496731-79496753 TAGGCTGTCAAGGAAAGGGTGGG - Intronic
1153590278 18:6666923-6666945 TTGGCTGTAAAGTAAGATACAGG - Intergenic
1155131563 18:22939895-22939917 TAGCCAGGCAAGGAAGATGGTGG + Intronic
1156438037 18:37154724-37154746 TAAGCTGTAAAGAAAGAGGCTGG - Intronic
1159988558 18:74874796-74874818 TTGGCTTTCAAGGAAATTGCAGG - Intronic
1160316363 18:77851445-77851467 TTGGCTGTCAAGGGAGGAGCAGG + Intergenic
1164542509 19:29131438-29131460 TAGACTGTCAAGGAAACTGAGGG + Intergenic
1164953062 19:32355163-32355185 GAGGCTGTCAAGGAGGCAGCAGG - Intronic
1165896228 19:39142809-39142831 CAGGCTGTCAAGAAGGAAGCAGG - Intronic
1168214047 19:54912240-54912262 TAGGCTCTGAAGGAAGGGGCTGG + Intronic
925042049 2:739993-740015 TAGGCTCTGAGGGAAGATCCTGG - Intergenic
925794087 2:7524280-7524302 TTGGCTGTCAAAGAAGACGATGG - Intergenic
928959372 2:36907751-36907773 TAGCATGTGAAGGAAAATGCTGG - Intronic
930940966 2:57013873-57013895 TAGCCTGTGAAAGCAGATGCAGG + Intergenic
932463284 2:71897186-71897208 TGGGCTGGCACGGAGGATGCTGG - Intergenic
934536897 2:95141595-95141617 GAGGCTGTTTAGGAAGATGCGGG - Intronic
935468919 2:103433304-103433326 TATGCTGTCAAGAAAAATGTGGG - Intergenic
936488470 2:112947740-112947762 TGGGCTGACAAGGAAAATGGAGG - Intergenic
938207214 2:129434141-129434163 TCTGCTGCCAAGGAACATGCTGG - Intergenic
940168867 2:150805009-150805031 TATGGTGTCAATGAAGATGCAGG + Intergenic
942469567 2:176245570-176245592 TAGGATGCAAAGGAGGATGCTGG + Intergenic
944371147 2:198985264-198985286 TAGTCTGTGAAAGCAGATGCAGG - Intergenic
946597269 2:221319884-221319906 TAAGCTGTCTTGGAAGATTCAGG - Intergenic
948016482 2:234695059-234695081 TCTGCAGTCAAGGAAAATGCAGG - Intergenic
948349512 2:237327126-237327148 CTGGCTGTCAAGGAAGGTCCTGG + Intronic
948929681 2:241124003-241124025 CAGGCTGGCAAGGAACAGGCGGG + Exonic
1173470124 20:43317069-43317091 TGGGTTGTCTAGGCAGATGCAGG - Intergenic
1174094438 20:48076968-48076990 GGGGCTGTCAAGGAGGAGGCAGG + Intergenic
1176190407 20:63806587-63806609 TATGCTCTCAAGGAATATGATGG + Intronic
1176728347 21:10463660-10463682 CAGCCTGTAAATGAAGATGCTGG - Intergenic
1179540280 21:42079297-42079319 TGGTCTGTGAAGGAGGATGCAGG - Intronic
1181999194 22:26906270-26906292 TAGGATGTCCAGGAATATGAGGG - Intergenic
1182191365 22:28464124-28464146 TAGTATGTGAAGGAAGATGATGG - Intronic
1183435857 22:37794597-37794619 GAGGCTGTCAAGGAGGAGGGGGG + Intergenic
1183677773 22:39309387-39309409 AAGGCTGTCAACGAAGATCTAGG + Intergenic
949700137 3:6746999-6747021 TAGGCTGTGAAAGAAGAAGAAGG - Intergenic
950603570 3:14057882-14057904 TAGGTTGTCAGGGAAGTTGGGGG + Intronic
950996312 3:17501119-17501141 AAGGTTGTCAAGGAAAATGGTGG - Intronic
953918982 3:46939007-46939029 CAGGCTGTTAACGAAGAAGCAGG - Intronic
954775094 3:53009918-53009940 TAGGCTGAAAAGGAAGAGGATGG + Intronic
958790540 3:98645871-98645893 TTGGCAGACAAGGAAGATGGTGG - Intergenic
965473432 3:169123886-169123908 TGGTCTCCCAAGGAAGATGCAGG + Intronic
965840014 3:172893803-172893825 TATACTGAGAAGGAAGATGCTGG + Intronic
965898285 3:173605719-173605741 AAGGCTGTCAAGGAATATAAAGG + Intronic
965983995 3:174729003-174729025 TAGTCTGTAAAGGAAGAGCCAGG + Intronic
968287250 3:197516132-197516154 AAAGGTGTCAGGGAAGATGCAGG - Intronic
970386606 4:15562984-15563006 TAGGCAGACAAGGAAGATGCAGG + Intronic
972782472 4:42297957-42297979 GAGACTGTCCAGGAACATGCTGG + Intergenic
977695269 4:99957776-99957798 TATGCTGTTTAGGAAGATGTAGG + Intergenic
977913257 4:102561976-102561998 GAGGGTGTCATGGAAGATTCAGG + Intronic
981820585 4:148882118-148882140 TGGACTTTCAAGGAAGTTGCTGG - Intergenic
981829289 4:148981573-148981595 GAGGCTGTCAGGGCAGATGCAGG + Intergenic
983217392 4:165014685-165014707 TAGGCAGTTAAAGAACATGCAGG + Intergenic
983977973 4:173959784-173959806 TAGGTTGTCATGGACAATGCAGG + Intergenic
987843441 5:23251620-23251642 TAAGAGGTCAAGGAAGATGATGG + Intergenic
988899999 5:35721883-35721905 TAGGATGTAAAGCAAGATGGAGG + Intronic
991025857 5:62028912-62028934 GGGGCTGTGAAGGAAGCTGCAGG - Intergenic
991061469 5:62380789-62380811 TAGGCTGAGGAGGAAGAGGCAGG + Intronic
994070775 5:95599462-95599484 AAGGCTGTGAGGGAAGAGGCTGG - Intronic
996946370 5:129074294-129074316 TAGGCTGTGGAGGAAGAGGGAGG - Intergenic
1001502807 5:172251916-172251938 TAGGATGGAAAGGAAGATGAGGG + Intronic
1003425065 6:5993745-5993767 GAAGTTGTCAAGGAAGATACAGG + Intergenic
1004708172 6:18143847-18143869 TAGGGTTTCAAAGAACATGCAGG + Intronic
1004808704 6:19234371-19234393 TAGCCTGTCATGGAAGATTGGGG - Intergenic
1005275825 6:24216342-24216364 TAGGCTGTCAAGGAAGATGCGGG + Intronic
1006579791 6:35070282-35070304 GAGGCTTTCTAGGAAGATGGGGG - Intronic
1006865148 6:37203382-37203404 GAGGCTGGAGAGGAAGATGCCGG + Intergenic
1008781097 6:55106353-55106375 TAGGTTGGCAGGGAAGTTGCTGG - Intergenic
1014688434 6:124532365-124532387 CAAGCTGTGAAAGAAGATGCAGG + Intronic
1020575915 7:9928087-9928109 AATACTGTCAAAGAAGATGCTGG - Intergenic
1023275146 7:38510743-38510765 CAGGCTGTAAAGGATGATGAAGG + Intronic
1024603270 7:51005457-51005479 TAGGGTGTCAAGAAAGCTGCTGG - Intergenic
1030328972 7:108252741-108252763 CAAGCTATCAAGCAAGATGCAGG + Intronic
1032584970 7:133138042-133138064 TGGGCTGTCAAAAAAGAGGCAGG - Intergenic
1034555090 7:151845379-151845401 TAGGTTGACAAGGACGCTGCTGG - Intronic
1035092943 7:156329533-156329555 CATGCTGCCAAGGAAGCTGCGGG + Intergenic
1036948287 8:13116209-13116231 CAGGCTGTCAAGGAACATGGAGG + Intronic
1036977993 8:13436202-13436224 TAGAATGTGAAGCAAGATGCAGG - Intronic
1037613819 8:20499037-20499059 TAGGCTGAGGAGGAAGATGAGGG - Intergenic
1038196612 8:25373917-25373939 GAGGCTGTACAGGAAGAGGCAGG + Intronic
1039750971 8:40478405-40478427 TATCCAGTCAGGGAAGATGCTGG + Intergenic
1042373712 8:68022765-68022787 TAGGCTGTAAAGGGACATGAAGG - Intronic
1043803100 8:84636554-84636576 TAGGCTGTCCAGCTAGATGGAGG - Intronic
1046102553 8:109631472-109631494 TGGGCAGTAAAGGAGGATGCAGG + Intronic
1047618607 8:126583907-126583929 GGGGCTGTTAAGCAAGATGCTGG - Intergenic
1048999218 8:139814053-139814075 GAGGCAGTGAGGGAAGATGCAGG - Intronic
1052771983 9:32698270-32698292 GAGGCTGTAGAGGAAGATACAGG - Intergenic
1057075594 9:92136653-92136675 TAGGCCATCAAGGACGAGGCTGG + Intergenic
1058996067 9:110299824-110299846 GAGGCTGTCAGGAAAGATGGCGG + Intergenic
1059812607 9:117872566-117872588 AAGGCTGTCAAGTAACCTGCTGG - Intergenic
1060218832 9:121753924-121753946 TAGGCTGGCAAGGCAGAGGCTGG + Intronic
1061947480 9:133916816-133916838 AGGGGTGTGAAGGAAGATGCTGG + Intronic
1186848153 X:13552248-13552270 CAGGCAGTCATGGAAGATACAGG + Intergenic
1187011993 X:15289022-15289044 TATGCTTGCCAGGAAGATGCTGG - Intronic