ID: 1005276393

View in Genome Browser
Species Human (GRCh38)
Location 6:24223744-24223766
Sequence GCTGCAGATCCTCAGACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005276393_1005276396 19 Left 1005276393 6:24223744-24223766 CCATGTGTCTGAGGATCTGCAGC 0: 1
1: 0
2: 2
3: 20
4: 225
Right 1005276396 6:24223786-24223808 GGCCAGTGTAACCACCAAAATGG No data
1005276393_1005276394 -2 Left 1005276393 6:24223744-24223766 CCATGTGTCTGAGGATCTGCAGC 0: 1
1: 0
2: 2
3: 20
4: 225
Right 1005276394 6:24223765-24223787 GCTAACAACAGTTGCCACTTTGG 0: 1
1: 0
2: 0
3: 10
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005276393 Original CRISPR GCTGCAGATCCTCAGACACA TGG (reversed) Intronic
900098365 1:949711-949733 GCTGGAGGCCCACAGACACAGGG + Intronic
900349863 1:2229237-2229259 GCTGGAGATCCTCAAAGTCATGG + Exonic
900839274 1:5034664-5034686 GCTGCAAATTATCAGACCCAAGG - Intergenic
901454266 1:9354195-9354217 GCTGCAGGCTCCCAGACACACGG - Intronic
901493323 1:9607618-9607640 GCTGGAGAGCCTCCGACACTCGG - Exonic
901818223 1:11806953-11806975 GCTGTAGATCCTCACCCACATGG + Intronic
903355122 1:22741778-22741800 GCTGCAAATCCCCACACACTGGG + Intronic
904484496 1:30815866-30815888 CCTGGAGATCCTCTGAAACAGGG + Intergenic
904500379 1:30909345-30909367 TCTGCAGATCCACAGTGACAGGG - Intergenic
906673497 1:47676981-47677003 GATGGAGAGCCTCAGAGACAGGG - Intergenic
907561797 1:55397743-55397765 GCTGCAGAAGTTCAGACCCAGGG - Intergenic
907578153 1:55547338-55547360 GCTGCAGCTCCTGAAAAACAGGG - Intergenic
911937823 1:104003015-104003037 GTTACAGATCCTCAAACTCATGG - Intergenic
912645351 1:111386930-111386952 CCTGCACTCCCTCAGACACAGGG + Intergenic
912682303 1:111737145-111737167 GCTGAAGCTGCTCAGACAAAGGG + Intronic
913019335 1:114771482-114771504 TTTGCAGATACTCAGGCACAAGG - Exonic
913666117 1:121050370-121050392 CCTGCACATGCTCAGACACACGG - Intergenic
914017518 1:143833646-143833668 CCTGCACATGCTCAGACACACGG - Intergenic
914656129 1:149742178-149742200 CCTGCACATGCTCAGACACACGG - Intergenic
914693634 1:150054833-150054855 GCTGCAGAAGCCCAGACACCAGG + Intergenic
914979410 1:152399476-152399498 GCTGCAGCTGCTCACGCACAGGG - Intergenic
916213804 1:162379254-162379276 ATTGCACATCCTCAGACATAGGG + Intronic
917122985 1:171660488-171660510 TCTGCAGCTCCTAAGAGACAGGG - Intergenic
918315572 1:183319851-183319873 ACTGCAGATGCTCAAAGACACGG - Intronic
919896476 1:202012553-202012575 GCAGCAGGTCATCAGACCCATGG + Intronic
920503208 1:206498506-206498528 TCTGCAGAACCTCAGATCCAGGG - Intergenic
922160162 1:223073814-223073836 GCTGTATGTCCTCAGACATAGGG - Intergenic
922516083 1:226209329-226209351 TCTACAGAGCCTCAGACACTGGG + Intergenic
922586143 1:226736447-226736469 GCTGCAGGTCCTCAAGCTCACGG + Exonic
1062842406 10:681353-681375 AATGCAGACCCTCAGTCACATGG + Intronic
1062842415 10:681411-681433 AATGCAGACCCTCAGTCACATGG + Intronic
1064237701 10:13591639-13591661 GCTGCAGAAGCCCAGACACCAGG - Intronic
1064410935 10:15103318-15103340 GCTGCAGCTCCTCAAGCACCGGG + Exonic
1065291593 10:24235785-24235807 TCTGCAGATCCTCCGAGATACGG - Intronic
1066476761 10:35754657-35754679 CCTGCAGCCCATCAGACACAGGG - Intergenic
1067078271 10:43200202-43200224 GATGCAGATCGTCAGCCACATGG - Exonic
1067750996 10:48970869-48970891 GGTGCACATCCTCAGACTCCTGG - Intronic
1069299296 10:66886463-66886485 GCTTTAGACCCTCAGAAACAGGG + Intronic
1069903053 10:71716949-71716971 GCTGCTCAGCCCCAGACACAGGG - Intronic
1073180187 10:101578855-101578877 GCTGCAGCAGCTCAGACACCAGG + Intronic
1074190285 10:111129564-111129586 GCTGCAAAGCCTCAGACATCTGG - Intergenic
1076032404 10:127170644-127170666 GCAGGAGATCCTCAGACCAATGG - Intronic
1076776435 10:132700419-132700441 TTTGCAGATCATCAAACACACGG - Intronic
1077015427 11:397089-397111 GCTCCAGCTGCTCAGACACCAGG - Exonic
1077409899 11:2399077-2399099 GCTGGAGGTGCTCAGACAAAGGG - Intergenic
1083688683 11:64393022-64393044 GCTGGAGAACCACAGAAACAGGG + Intergenic
1084943972 11:72629099-72629121 GCTCCAGATCCTCGGTCAGAGGG + Intronic
1085359571 11:75874790-75874812 ACTGAAGATTCTGAGACACAGGG + Intronic
1089314831 11:117584258-117584280 GTGCCAGATCCTCAGACACTGGG + Intronic
1089330703 11:117687033-117687055 TCTGCAGAGCTGCAGACACAGGG + Intronic
1089605440 11:119638730-119638752 CCTGGATATCCTCAGGCACAAGG + Intronic
1089857405 11:121558669-121558691 ACTTCACATCCTCAGACACCAGG - Exonic
1090823057 11:130362302-130362324 ACTGCAGATCCACAGACTCCTGG - Intergenic
1092131173 12:6114283-6114305 GCTGTAGATCAGCAGCCACAGGG - Intronic
1094153290 12:27310370-27310392 GATGCATAGCCTCAGAGACAGGG + Intronic
1095886019 12:47189289-47189311 GCTGCATCTCCTCAGAGAAAAGG - Intronic
1097392076 12:59027028-59027050 GATGCACATCATCAGACACTTGG - Intergenic
1097394269 12:59054679-59054701 CCTGCACACCCTCAGACATAAGG - Intergenic
1097995212 12:65881254-65881276 TCTGGAGACCCTCAGAGACAAGG - Intronic
1099479863 12:83151986-83152008 GCTGCAGAAGCCCAGACACCAGG + Intergenic
1102742502 12:115220803-115220825 GCACTAGATCCTCAGATACATGG - Intergenic
1103341486 12:120223482-120223504 GCTTCAGTTCCTCAGCTACACGG + Intronic
1104456766 12:128920930-128920952 CCTGCTGATGCTCAGAGACAGGG - Intronic
1104896665 12:132168217-132168239 GCTGCTGAGCCTCAGGCCCACGG + Intergenic
1105741175 13:23324578-23324600 GCCCCAGATCCTCACACCCAGGG + Exonic
1106592229 13:31107999-31108021 GCTGCAGAGGCACAGAGACATGG - Intergenic
1107354131 13:39547652-39547674 GCTGCTAAACCTCAGACAGAAGG + Intronic
1108417080 13:50208907-50208929 CCAGCAGAACCTCAGGCACAAGG - Intronic
1109309798 13:60679072-60679094 GCTGCAGTTGCTAAGATACATGG - Intergenic
1109476187 13:62882693-62882715 GCTGCAGAGGTTGAGACACAGGG + Intergenic
1109482483 13:62973985-62974007 GCTGGAGTGGCTCAGACACAGGG + Intergenic
1111325850 13:86695046-86695068 GCTGGAGATGCTGGGACACAGGG + Intergenic
1111485610 13:88895453-88895475 GCTGCAGCTGCCCAGCCACAGGG + Intergenic
1112228674 13:97566280-97566302 CCTCCCCATCCTCAGACACAAGG + Intergenic
1114519061 14:23321616-23321638 GCTCCAGTTCCTCAGACTCCAGG - Exonic
1115467391 14:33730642-33730664 ACTGCACTTCCTCAGCCACACGG - Intronic
1118838853 14:69496200-69496222 GCAGAAGATCATTAGACACATGG - Intronic
1119003998 14:70907865-70907887 GCTGCAGATCCTCCGACAGGGGG + Exonic
1120689890 14:87580782-87580804 GCTTCAGATCCACAGCCAGAGGG + Intergenic
1121954827 14:98204394-98204416 GCTGCAGTGCCTCAGAATCAGGG + Intergenic
1125671220 15:41474227-41474249 GCTGCAGGTCCTCATACAAGGGG - Intronic
1126698191 15:51342814-51342836 GCTGCAGACCCTCATCCACATGG - Intronic
1126890060 15:53195422-53195444 GCTGCAGACCAACAGAAACATGG + Intergenic
1127792079 15:62407009-62407031 GATGCAGATTCTGAGACAGAAGG - Intronic
1127864743 15:63023195-63023217 ACTGGAGAAACTCAGACACAAGG + Intergenic
1130539057 15:84808741-84808763 GCTGCAGATCCACTGTCACTTGG - Intergenic
1131797440 15:96034141-96034163 CCTGCATGTCCCCAGACACAAGG - Intergenic
1131965036 15:97833287-97833309 GATGAAGATCCTCTGACAGATGG + Intergenic
1132066812 15:98737970-98737992 GCAGCAGACCTTCATACACAAGG - Intronic
1132091591 15:98951735-98951757 GCTACACATCCTGAGACACTTGG - Intronic
1132381454 15:101369360-101369382 GCTGCAGAGATTCAGAAACAGGG - Intronic
1132463605 16:67597-67619 GCTGCAGGTCCTCCCACACAGGG - Intronic
1132766182 16:1535462-1535484 GCTGCAGAGCCTCACAGACTCGG + Intronic
1132909818 16:2303728-2303750 GCTTCAGAGCCTGAGACAGAGGG - Intronic
1133768602 16:8854823-8854845 TCTCCAGCTGCTCAGACACATGG - Exonic
1134789270 16:16973996-16974018 CCTGGAGATCCTCAGATAAAAGG - Intergenic
1135181827 16:20281540-20281562 CCTGCCATTCCTCAGACACACGG - Intergenic
1136396047 16:29993124-29993146 GCTTCTGTTCCACAGACACAGGG + Exonic
1137254121 16:46761014-46761036 TCTGCAGAAACTCAGCCACATGG + Intronic
1137707743 16:50547634-50547656 GCTGCAGTTCGCCAGACCCAAGG - Intergenic
1138205391 16:55120628-55120650 CCAGCAGATACTCAGACACATGG + Intergenic
1139470681 16:67176609-67176631 GCTGCAGGTCCCCAGACCCCAGG + Exonic
1140935008 16:79662271-79662293 CCTGCAGATCCTTGGACAAAAGG + Intergenic
1141609562 16:85173619-85173641 TCTGCAAATCCTCAAACACAGGG + Intronic
1142673385 17:1497996-1498018 GCTGTAGCCCCTCAGAGACAAGG + Exonic
1143953800 17:10653603-10653625 GCTGGAGGACCTCAGGCACAGGG + Intronic
1144251425 17:13420483-13420505 GCTGCAAAGTCTGAGACACAGGG - Intergenic
1145019301 17:19417088-19417110 GATGCAGCTCCTCAAACACCAGG + Exonic
1147539948 17:41348884-41348906 ACTTCAGATCCTCAGACTCCTGG - Intronic
1147899457 17:43774517-43774539 GTTGCACATCCTGTGACACACGG + Intronic
1148239412 17:45990278-45990300 GCAGCAGCTCCTAAGACACCTGG + Intronic
1148987403 17:51635181-51635203 GACACAGAGCCTCAGACACAGGG + Intronic
1149986045 17:61347853-61347875 GCAGCAGATGCACAGACACAGGG + Intronic
1150424850 17:65069057-65069079 GCTGTAGAACCTCAGAGGCAAGG - Intergenic
1154028321 18:10727120-10727142 GCTGCAGATCCCCAGGCCCCAGG - Intronic
1154425963 18:14272283-14272305 GCTGCAGAGGCACAGACACATGG + Intergenic
1155764070 18:29605603-29605625 GCTGGAGAAGCTGAGACACAGGG - Intergenic
1158234967 18:55302449-55302471 AATGCAGATGCTCAGATACAGGG - Intronic
1159860802 18:73647064-73647086 CCTTCAGGTGCTCAGACACATGG + Intergenic
1165755638 19:38291206-38291228 TCTGCAGCTCCACAGCCACATGG + Intronic
1166504389 19:43361951-43361973 GCTCCAGCTCCTCAGACCCAGGG - Intronic
1167717657 19:51154266-51154288 GCTGCATGTCCTCAGACCCGAGG - Intergenic
1167793930 19:51696959-51696981 CCTGTAGATCCTCATAGACAGGG + Intergenic
1167924166 19:52809972-52809994 GCTCCAGTTCCTCAGACTCCAGG - Intronic
927582780 2:24269128-24269150 GATGCAGTTCCTGAGAAACATGG - Intronic
927676446 2:25110055-25110077 GCTGCACAGCCTGAGTCACAAGG - Intronic
929096504 2:38267538-38267560 GGTCCAGATCCTCAGACTCCTGG - Intergenic
929903865 2:46029199-46029221 GGTGGATATCCTGAGACACAGGG + Intronic
930259583 2:49129526-49129548 GCAGCAGATCCAGAGACAGATGG + Intronic
930309596 2:49722861-49722883 GCTTCACATCTTCAGTCACAAGG + Intergenic
931038196 2:58266640-58266662 GCCACAGATCCTCAAACACCAGG - Intergenic
934041563 2:88131301-88131323 CCTGCTGTTCCTCAGACACCAGG - Intergenic
934989717 2:98912727-98912749 GCTGCACATGCTCTGACTCACGG + Intronic
937316310 2:120933975-120933997 GCTGCAGATCTGAACACACAGGG + Intronic
938132674 2:128731209-128731231 GGTGAAGACACTCAGACACAAGG + Intergenic
946997332 2:225409304-225409326 GCTGCATATGCACACACACAAGG - Intronic
947870533 2:233435193-233435215 GCTGCAGAGTGTGAGACACAGGG - Intronic
948863457 2:240763905-240763927 GCTGCAGAGCCTCAGCATCAGGG + Intronic
948927288 2:241107467-241107489 GCTGCAGCAGCCCAGACACAAGG + Exonic
1171179158 20:23079219-23079241 GGTGCAGAAACTCAGCCACAAGG + Intergenic
1171425964 20:25048846-25048868 GCTGCTAATCCTCAGTCTCACGG - Intronic
1172391592 20:34568806-34568828 ACTGCAGACCCTCAGATACTGGG - Intronic
1173832387 20:46099607-46099629 GCGGAAGATCCGCAGACTCAGGG + Intergenic
1174411744 20:50340994-50341016 GCTGGAGATCCTCAAAGCCAGGG - Intergenic
1179154545 21:38838637-38838659 GCTGCAGAACCCCAGTCACATGG - Intergenic
1179578559 21:42322912-42322934 TCTGCAGATCCTTGGACACTGGG + Intergenic
1179618998 21:42600101-42600123 GCTGCAGGGCCTGAGTCACAGGG + Intergenic
1179830138 21:43991567-43991589 GCTGCAGCTCCTCAGACCAGTGG + Intergenic
1180631341 22:17232308-17232330 GATGCAGGTCCTCAGACAGCAGG - Intergenic
1181491293 22:23262396-23262418 GCTGCAGACCCCCAGACTCCAGG + Intronic
1182811103 22:33117343-33117365 GCTGCAGATCCTCAGAGTAAAGG + Intergenic
1185119179 22:48955681-48955703 TCGGCAGATGCTCACACACACGG - Intergenic
950128147 3:10523592-10523614 GCAGCAGCACCTCTGACACATGG + Intronic
950457422 3:13101015-13101037 CTTGCAGCTCTTCAGACACATGG - Intergenic
951461803 3:22959105-22959127 GAAGCTGTTCCTCAGACACAAGG + Intergenic
953562331 3:44001261-44001283 CATGCAGATGCTCAGAAACAGGG - Intergenic
954631803 3:52051818-52051840 ACTCCAGCTCCTAAGACACATGG + Intronic
954810142 3:53242483-53242505 GCATCAGATCCTCAGAATCACGG + Intronic
956665763 3:71640733-71640755 GCTGCAGATCCCCAGTCAAAGGG + Intergenic
960693212 3:120369191-120369213 GCTACAGATACTTTGACACAAGG - Intergenic
961166798 3:124769223-124769245 GCTGCAGATGTTCAGCCTCAGGG + Intronic
962695004 3:137939364-137939386 ACTGCTGATCCCCAGACACAAGG + Intergenic
962849190 3:139295160-139295182 GCTGCTGAACCTCAGACCTAGGG - Intronic
964669851 3:159213060-159213082 ACTGCTGCTCCTCAGACCCAAGG + Intronic
967476683 3:189929347-189929369 GTTGCAGATCCTGAAACACTGGG - Intergenic
968515502 4:1013887-1013909 GCTGGATATCCTCAGCCCCAAGG - Intronic
969047737 4:4349265-4349287 TCTGCAGACCCACAGAGACATGG - Intronic
969723535 4:8906371-8906393 CCTGCAGCTCCTCAGACAGGTGG + Intergenic
969725519 4:8915993-8916015 GCTGCAGGTCTTAGGACACAGGG - Intergenic
971892616 4:32544412-32544434 TCTGCATACCCTCAGGCACATGG - Intergenic
972450711 4:39195494-39195516 GCTGCATATCCTGAGGCAAATGG - Intronic
973292691 4:48484979-48485001 GCTGTAGATCCACAGGCACAGGG - Exonic
973984378 4:56336509-56336531 GCTGCTGATACCCAGACAAACGG - Intergenic
976419928 4:84829957-84829979 GCTACAAATCCTCAGAGTCAGGG - Intronic
981479189 4:145219453-145219475 ACTGCAGATACACAGACCCAAGG - Intergenic
985381974 4:189404499-189404521 GCTGGAGAGGCTGAGACACAGGG - Intergenic
985523647 5:391035-391057 GCAGAACATCCTCAGACAGACGG + Intronic
985538962 5:479026-479048 CCTGCAGACCCTCACACAGAGGG - Intronic
988440603 5:31228369-31228391 GCTGCAGATCCCCAGTGCCAAGG + Intronic
988609108 5:32709203-32709225 GCTGGTGTTCCGCAGACACAGGG + Intronic
988829796 5:34976471-34976493 TCTCCAGATCCACACACACAGGG - Intergenic
989398420 5:40983218-40983240 GATGCAGACCCTGAGACAAAAGG + Intergenic
991973646 5:72164724-72164746 TCTGCATATCCTCAGGGACAGGG + Intronic
996372277 5:122766345-122766367 GCAGCAGATTCTCAGAACCAGGG + Intergenic
997055554 5:130439001-130439023 GCTCCAGATCCCCAGAAAGAAGG + Intergenic
999080579 5:148839666-148839688 GCTGCAGATCATAACACTCAAGG + Intergenic
1000000886 5:157137553-157137575 GGCAGAGATCCTCAGACACAAGG + Exonic
1002560645 5:180079744-180079766 CCTGCAGATGCTCAGACACAGGG + Intergenic
1003791535 6:9552266-9552288 GCTGTAGAGCCTGGGACACACGG + Intergenic
1004605710 6:17193281-17193303 GCTGCATATGATAAGACACATGG + Intergenic
1005276393 6:24223744-24223766 GCTGCAGATCCTCAGACACATGG - Intronic
1007079312 6:39087449-39087471 ACTGCAGATAGCCAGACACATGG + Exonic
1007970048 6:46042778-46042800 GATGCAGAACCTCAGAGAGATGG + Intronic
1008236608 6:49058501-49058523 GCTGCTGATACTCAGGCAAACGG + Intergenic
1010667532 6:78647595-78647617 GCTGCTGATACCCAGGCACACGG + Intergenic
1015497474 6:133896054-133896076 GCTGCAGATCCGCTGGCTCAGGG + Intergenic
1015687178 6:135877677-135877699 GAAGCAGATCCTGAGACTCAAGG + Intronic
1015790231 6:136958051-136958073 AGTGCAGATCCTCAGAAGCAAGG - Intergenic
1017116623 6:150983514-150983536 GCTGCAGAGCCTGGGACAAAGGG - Intronic
1018455349 6:163946842-163946864 CCTGCAGACCCACAGTCACATGG + Intergenic
1018558191 6:165072123-165072145 GCTGCAGCTCCTCTGACAGGAGG - Intergenic
1020963188 7:14831689-14831711 GCTGCAGATCCTCGGATGCTAGG - Intronic
1022510346 7:30931462-30931484 GCTGCTGAGACCCAGACACAGGG - Intergenic
1024692640 7:51819524-51819546 CCTGCTGTTCCACAGACACAAGG + Intergenic
1024837579 7:53540923-53540945 GCAGGAGATCCGCAGACCCAGGG - Intergenic
1026777635 7:73240647-73240669 GGTGCCTATCCTTAGACACAGGG - Intergenic
1027018490 7:74794019-74794041 GGTGCCTATCCTTAGACACAGGG - Intergenic
1027069539 7:75151899-75151921 GGTGCCTATCCTTAGACACAGGG + Intergenic
1027834122 7:83219144-83219166 GCTGGAGAGGCTGAGACACAAGG - Intergenic
1028447591 7:90942699-90942721 GCCACAGAGCCTCAGAAACATGG + Intronic
1028745326 7:94320612-94320634 GCTGCAGCAGCTGAGACACAGGG + Intergenic
1029618063 7:101672288-101672310 GCTTGTGATCCTCAAACACACGG - Intergenic
1029709358 7:102291181-102291203 TCTGCAGACCCTCAGTCCCAGGG - Intronic
1031013583 7:116548808-116548830 CTTGCAGGTCCTCACACACAGGG + Intronic
1032933540 7:136702102-136702124 GCTGCAGATCCTGAGAGATGAGG + Intergenic
1033481839 7:141749949-141749971 GCAGCACATCCTCAGAGAAAAGG - Intronic
1035355577 7:158274339-158274361 GCGGGAGAGCCACAGACACAGGG + Intronic
1035854380 8:2958598-2958620 GCTGCAGATACACAGAACCATGG - Intronic
1036129001 8:6091044-6091066 GCTGCTGATACCCAGACAAATGG - Intergenic
1037700913 8:21273130-21273152 GCTGTTGATCCCCAGAGACATGG - Intergenic
1040071555 8:43192861-43192883 GCAGCAGACCCTGAGACAGAGGG + Intronic
1041311528 8:56522507-56522529 TCTGCAGTTCCTCATACACTTGG + Intergenic
1044457857 8:92409877-92409899 GCTGCAGAAGCTAAGAGACATGG - Intergenic
1044496762 8:92896245-92896267 GCTGCAGCTCCGGGGACACAAGG + Intronic
1049010552 8:139884375-139884397 GCTGCCGACCCTCAGACAGAAGG + Intronic
1049602289 8:143513462-143513484 GCTGGAGACTCTCAGGCACAAGG + Intronic
1049671706 8:143872953-143872975 GCTGCAGGGCCTTGGACACAGGG + Exonic
1049792832 8:144479911-144479933 GCTGCTGAGCCTCTGGCACAGGG - Intronic
1050652228 9:7787652-7787674 ACTGCAGATCCTCCCCCACAAGG + Intergenic
1052310874 9:27067875-27067897 TCCCCTGATCCTCAGACACAAGG - Intergenic
1052534581 9:29731105-29731127 GCTGAACACCCTCAGAGACAGGG - Intergenic
1053042234 9:34884677-34884699 GTTGGAGATCCTCAGACACAAGG - Intergenic
1060403268 9:123360591-123360613 GATGCAGATTCTCAGGCTCAGGG + Intronic
1061008698 9:127942842-127942864 GCTGCATGTCCTCAGCCAGAGGG + Exonic
1061052690 9:128205545-128205567 GCTGCACATCCTCTGACAGCCGG + Intronic
1062106525 9:134757923-134757945 GCAGCAGACACTCACACACACGG + Intronic
1185576243 X:1174910-1174932 GCTGCAGAAGCCCAGACACCAGG + Intergenic
1185749985 X:2603269-2603291 TCTGCAGATCGACAGACGCAAGG - Intergenic
1186170686 X:6872902-6872924 TTTGCAGATCCTGTGACACATGG + Intergenic
1187101607 X:16198610-16198632 GCTGCAGAAGCCCAGACACCAGG - Intergenic
1190883404 X:54509805-54509827 GATGCAGATACTCAGAGACATGG + Intergenic
1192473689 X:71420831-71420853 GCTACAGTTCCTCAGACTCCAGG + Intronic
1198688544 X:139253920-139253942 AAAACAGATCCTCAGACACACGG + Intergenic
1199458739 X:148059507-148059529 GCTGGAGCTGCTGAGACACAGGG + Intergenic
1199687808 X:150280128-150280150 GCTGCAGCTCCTCAGAAATGAGG - Intergenic
1199975706 X:152893827-152893849 GCTTCAGAGCCACAGACAAAAGG + Intergenic
1199982486 X:152928599-152928621 CCTGCAGATCCTGACACCCAGGG + Exonic
1201404913 Y:13640235-13640257 GCTGCAGACGCTCAGTGACAAGG + Intergenic