ID: 1005276396

View in Genome Browser
Species Human (GRCh38)
Location 6:24223786-24223808
Sequence GGCCAGTGTAACCACCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005276393_1005276396 19 Left 1005276393 6:24223744-24223766 CCATGTGTCTGAGGATCTGCAGC 0: 1
1: 0
2: 2
3: 20
4: 225
Right 1005276396 6:24223786-24223808 GGCCAGTGTAACCACCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005276396 Original CRISPR GGCCAGTGTAACCACCAAAA TGG Intronic
No off target data available for this crispr