ID: 1005279604

View in Genome Browser
Species Human (GRCh38)
Location 6:24258924-24258946
Sequence GATGTGTTCTAGAGAACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 9, 3: 22, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005279604_1005279606 -5 Left 1005279604 6:24258924-24258946 CCCTTTGTTCTCTAGAACACATC 0: 1
1: 0
2: 9
3: 22
4: 253
Right 1005279606 6:24258942-24258964 ACATCTTCATTGTGCACTAAAGG 0: 1
1: 0
2: 1
3: 13
4: 134
1005279604_1005279607 10 Left 1005279604 6:24258924-24258946 CCCTTTGTTCTCTAGAACACATC 0: 1
1: 0
2: 9
3: 22
4: 253
Right 1005279607 6:24258957-24258979 ACTAAAGGCTGCAATCTCCTTGG 0: 1
1: 0
2: 0
3: 5
4: 119
1005279604_1005279609 29 Left 1005279604 6:24258924-24258946 CCCTTTGTTCTCTAGAACACATC 0: 1
1: 0
2: 9
3: 22
4: 253
Right 1005279609 6:24258976-24258998 TTGGTTTGCAAACTGTTCACAGG 0: 2
1: 13
2: 25
3: 61
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005279604 Original CRISPR GATGTGTTCTAGAGAACAAA GGG (reversed) Intronic
900909629 1:5585889-5585911 GATGTGTTCAAGAGACATAAAGG + Intergenic
901096601 1:6685704-6685726 GGTGGGTTCCAGAGAACAAAAGG - Intronic
903089992 1:20905441-20905463 TAAGTTTTCTAGACAACAAAAGG + Intronic
909720623 1:78765241-78765263 CATGTGTACTATAGAACAAATGG - Intergenic
910356934 1:86368593-86368615 GATGAGGTATAGAGAACTAATGG + Intronic
910523829 1:88154693-88154715 GTTTTATTCTAGAGAAGAAAAGG - Intergenic
912164930 1:107031617-107031639 GATGTGATCTGGTGCACAAATGG - Intergenic
913142679 1:115956830-115956852 GCTGGGTTCTAGAGAAGAAGAGG - Intergenic
915305936 1:154978420-154978442 GATGTGTTCTAAATAAGCAAAGG + Intronic
917633711 1:176915651-176915673 GTTGGGTTCTGGGGAACAAAGGG - Intronic
918682886 1:187377473-187377495 GTTGTGTTCTGGGGAACAAAGGG - Intergenic
918873445 1:190007166-190007188 GGTGTGTTCCAGGGAACAAATGG - Intergenic
918976843 1:191499597-191499619 ATTGTATTCTAGATAACAAATGG - Intergenic
919472243 1:197994291-197994313 GAGGTCTTGTATAGAACAAAAGG - Intergenic
919595359 1:199554906-199554928 AATCTGTACTATAGAACAAATGG + Intergenic
919712834 1:200745307-200745329 GATGTCTCCTGGGGAACAAAAGG + Intronic
920736164 1:208534643-208534665 GAAGAGTTCCAGAGAACAGATGG + Intergenic
921447227 1:215260936-215260958 GATGTGTATTAGAAAACAATGGG - Intergenic
921979180 1:221236428-221236450 CAGGATTTCTAGAGAACAAAAGG - Intergenic
922346456 1:224700564-224700586 GATGTGCTTTAGAGAAAGAAAGG + Intronic
923499150 1:234550310-234550332 CATGTGTTCTTGGGAAGAAAGGG + Intergenic
923854446 1:237830515-237830537 CATTTGGTCTAGAAAACAAAGGG - Exonic
924801915 1:247334019-247334041 GATCTGTGCTACAGAAAAAAAGG + Intergenic
1063345394 10:5307225-5307247 GATGTGTTCCAGGGAACAAAGGG - Intergenic
1064540107 10:16396576-16396598 GTTGTATTCTAGAGGAGAAAAGG - Intergenic
1065671208 10:28120131-28120153 GATATTTTGCAGAGAACAAAAGG + Intronic
1066071806 10:31823341-31823363 TATCTGTCCTAGAGAAGAAAAGG + Intronic
1066142667 10:32523175-32523197 AATCTGTACTACAGAACAAATGG - Intronic
1066620984 10:37349473-37349495 GATCTGTACCAAAGAACAAACGG - Intronic
1067745254 10:48930874-48930896 CATGTGTGCCAGAGAACACAGGG - Intronic
1068084643 10:52360149-52360171 GATGTCTTTTAGATTACAAAAGG - Intergenic
1068448073 10:57149012-57149034 AATGTGTACTGGAGACCAAATGG + Intergenic
1068732063 10:60369472-60369494 GCTGTGGTCTACAGCACAAAAGG + Intronic
1069343860 10:67444026-67444048 AATCTGTGCTATAGAACAAATGG + Intronic
1070457581 10:76632586-76632608 CAAGTTTTCAAGAGAACAAAGGG + Intergenic
1073628743 10:105126396-105126418 GAATTGTTCTACATAACAAATGG - Intronic
1076407780 10:130224690-130224712 GAAGAGCTCTAAAGAACAAAAGG - Intergenic
1078494327 11:11800814-11800836 GATGTCTACTAGAGACCCAAGGG + Intergenic
1079814690 11:25040718-25040740 GATGAGTTGTAGAGATGAAAGGG + Intronic
1080467024 11:32507195-32507217 GGTATGTGCTAGAAAACAAAAGG - Intergenic
1080991488 11:37542016-37542038 GATATGTCTTAGAGTACAAAAGG + Intergenic
1087137892 11:94739232-94739254 CATGAGTTCCAGAGGACAAATGG + Intronic
1088501231 11:110485189-110485211 GGCATGTTCCAGAGAACAAAGGG - Intergenic
1089659208 11:119975120-119975142 GATGTGTTCTAGCCAGTAAAGGG + Intergenic
1089790624 11:120940884-120940906 GATCTGTCCTGGAGAATAAATGG + Intronic
1090569870 11:128034170-128034192 GAGGTGTTCTAGAAAAAATAAGG - Intergenic
1093275296 12:17117717-17117739 GATTTGATCTAGTGAAGAAAGGG + Intergenic
1093629596 12:21392619-21392641 GAGGTGCACTAGAGATCAAAGGG - Intronic
1094082396 12:26551909-26551931 AATGTTTTCTAGAGAAAATAGGG + Intronic
1095788754 12:46141022-46141044 TATGTGTGCTATAGACCAAATGG - Intergenic
1096394734 12:51257243-51257265 GATGAGATCTAGAGCACAGAGGG + Intronic
1097898239 12:64847893-64847915 AATCTGTACTATAGAACAAATGG - Intronic
1098226369 12:68329321-68329343 AATTTGGTCTAGAGAACAAAGGG - Intronic
1098450703 12:70615412-70615434 GATGTGTTCTAGAGAGACAGTGG - Intronic
1098732360 12:74053092-74053114 GATGAGTTCATGAGAACATATGG + Intergenic
1100012505 12:89970415-89970437 GATATATTCTAAAGAGCAAATGG - Intergenic
1100945707 12:99781398-99781420 GATTTGTTTTAAAGATCAAAAGG - Intronic
1102392546 12:112561186-112561208 CATGTCTTCTAGTGAGCAAATGG + Intergenic
1103018408 12:117514065-117514087 CATGTGTTCCAGAAAGCAAAGGG - Intronic
1103316646 12:120061549-120061571 GTTTTGGACTAGAGAACAAATGG + Intronic
1104662572 12:130621642-130621664 TATGTGTCCTGCAGAACAAAAGG + Intronic
1105893703 13:24700311-24700333 GATGATTTCTAGGGAAAAAAGGG - Intronic
1106021908 13:25923664-25923686 GATGTCTTCTAGGGGACAGAGGG - Intronic
1106898187 13:34328039-34328061 GCTGTGTTCTACAGAATATATGG - Intergenic
1106929142 13:34645050-34645072 GTGGTGTTCTAGAGAGCCAAGGG + Intergenic
1106967972 13:35095916-35095938 GATGTGTTCTAGACAGGAAGTGG + Intronic
1107114164 13:36728439-36728461 GATGTGTTCCAGAGAACACAGGG + Intergenic
1109509829 13:63355632-63355654 CATGTGTTCTTTAGAACAAATGG - Intergenic
1110778759 13:79440428-79440450 AATGTGTTTCAGAGAACTAAAGG - Intergenic
1111356092 13:87104456-87104478 AATGTGTGCTATAGACCAAATGG - Intergenic
1111371107 13:87318906-87318928 GATATGTTAGAAAGAACAAATGG + Intergenic
1112099841 13:96176359-96176381 GAAGTATTCTAGATAATAAATGG + Intronic
1112911249 13:104486992-104487014 GACGTGTTCAAGAAAACAGAGGG - Intergenic
1114846824 14:26332709-26332731 GATGTGTTCTTTAAAAAAAAAGG + Intergenic
1115389348 14:32836870-32836892 GGTGTGTTCTTCAGAAAAAAAGG + Exonic
1115898638 14:38119269-38119291 GGTGTGTTCCAGAGAACAAAAGG - Intergenic
1116654148 14:47629796-47629818 AATGTCTACTAGAGAAGAAAAGG + Intronic
1116766230 14:49073527-49073549 AATCTGCTCTATAGAACAAATGG + Intergenic
1116786737 14:49296413-49296435 GAAGTGTTCTTGAAAAAAAAAGG - Intergenic
1117406008 14:55404695-55404717 TATGTGCTCTAGTGAACCAAGGG - Intronic
1118133396 14:62993613-62993635 GATGTGTTCAGGAACACAAAGGG - Intronic
1118561584 14:67089737-67089759 GATGTCTTCTAGAGAATTAGAGG - Intronic
1119311785 14:73653044-73653066 GGTGTGTTCCAGAGAACAAAGGG + Intronic
1120169273 14:81232709-81232731 GATGGATTTTAGAGAACAAGTGG + Intergenic
1121667188 14:95681459-95681481 GATGTGTTCCAGAGCACAAAGGG - Intergenic
1121706536 14:96000114-96000136 TATGTCTCCTACAGAACAAATGG + Intergenic
1122058940 14:99123794-99123816 GATGGGTCCGGGAGAACAAAGGG - Intergenic
1126708759 15:51432615-51432637 GATCTGCCCTATAGAACAAATGG + Intergenic
1127019040 15:54724828-54724850 AATCTGTACTATAGAACAAATGG - Intergenic
1127094568 15:55499442-55499464 GGTGCATTCCAGAGAACAAAGGG - Intronic
1127216959 15:56833494-56833516 GTTGAGTACTAGAGATCAAAGGG + Intronic
1127414726 15:58747127-58747149 GGTGTGTTTGAGAGCACAAAAGG - Intronic
1128531077 15:68448390-68448412 GATGGGTGCTAGACCACAAAAGG + Intergenic
1129627933 15:77224633-77224655 GTTGTGCTCTAGTGTACAAAGGG + Intronic
1138087246 16:54144137-54144159 CAGGTGTTCTAGAGACCAGAGGG + Intergenic
1140697984 16:77553799-77553821 GCTGTGTTCTATAGAACATCAGG + Intergenic
1141534001 16:84666269-84666291 GATTTGTGCTGGACAACAAATGG + Intronic
1143964844 17:10749801-10749823 CATGTGTTATTGAGAACACACGG + Intergenic
1144602750 17:16632909-16632931 CATGTGTTCTGGAAATCAAAAGG - Intronic
1145114758 17:20198845-20198867 GATGTGTTCCAGAAAAACAAGGG - Intronic
1146028235 17:29341743-29341765 GATGTGTTCTAGAGCACTTATGG + Intergenic
1146603594 17:34239003-34239025 CTGGTTTTCTAGAGAACAAAGGG - Intergenic
1146970781 17:37070159-37070181 GGTGTCTTCTGGAGCACAAAAGG + Intergenic
1153336815 18:3933393-3933415 AATGGGGTCTTGAGAACAAATGG - Intronic
1153944108 18:10003696-10003718 GATGGGTACTAGTGAAGAAAAGG + Intergenic
1156672602 18:39488805-39488827 AATGTATTCCAGACAACAAAGGG - Intergenic
1158083177 18:53618259-53618281 CATGTGTTATAGAGAATAAGTGG - Intergenic
1159459759 18:68709665-68709687 GATGTGCTGTAAAGAAAAAATGG - Intronic
1160675314 19:387971-387993 GATGTGTACTCGAGGACACACGG - Intergenic
1160675365 19:388338-388360 GATGTGTACTCGAGGACACACGG - Intergenic
1162482988 19:10940088-10940110 GGTGCATTCCAGAGAACAAAGGG - Intergenic
1167811583 19:51837164-51837186 GGTGTGTTCCAGGGAACAGAGGG + Intergenic
925725824 2:6870115-6870137 GGTATTTTCCAGAGAACAAAAGG - Intronic
926478896 2:13363412-13363434 AATGTGTACTGTAGAACAAATGG + Intergenic
927080791 2:19628349-19628371 AATGTGCACTATAGAACAAATGG + Intergenic
927092858 2:19725708-19725730 GGTGTGTTCCAGAGAACAAAGGG - Intergenic
929505861 2:42527372-42527394 GGTGTGGTCCAAAGAACAAAGGG - Intronic
931199123 2:60080123-60080145 GATGTGACCAAGAGAAAAAATGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933352642 2:81174780-81174802 GATATGTTTTCAAGAACAAAAGG + Intergenic
933447244 2:82397649-82397671 GATGTGAACTATAGTACAAATGG - Intergenic
935192299 2:100788189-100788211 AATTTGTTCCAGAGAGCAAAAGG - Intergenic
935529222 2:104212425-104212447 AATGTGTCCTGGAGAACAGATGG + Intergenic
936347292 2:111684914-111684936 GTTGTTTTCTAGAGGACCAAGGG + Intergenic
937152522 2:119695808-119695830 GATGTGGTGTATAGCACAAATGG + Intergenic
937773240 2:125746465-125746487 GTTGTTTCTTAGAGAACAAAAGG - Intergenic
939420033 2:141955322-141955344 TATGTGTTTTAGATGACAAATGG + Intronic
940276884 2:151948900-151948922 TATGAGATCTAGAGAATAAATGG + Intronic
940450160 2:153826870-153826892 GGTGTGTTCTAGAGAAAATGAGG + Intergenic
940631619 2:156246924-156246946 GAGGTTTTCTAGAGATCAAGAGG - Intergenic
941713979 2:168744826-168744848 GATGGGAAATAGAGAACAAAAGG + Intronic
943559934 2:189448878-189448900 AATGTGTTCCAGACACCAAATGG - Intronic
943581007 2:189683512-189683534 GATGTGAGGTAGGGAACAAAAGG + Intronic
945162070 2:206902307-206902329 AATGTGCACTACAGAACAAATGG - Intergenic
945851840 2:215017423-215017445 GATGTGGTCAAGGGAACTAAGGG - Intronic
947227224 2:227852353-227852375 GATGTGCTCCAGAGAACCACTGG - Intergenic
1169035144 20:2444590-2444612 GATGCTTTCCAGAGAACAAAGGG + Intergenic
1169660761 20:7975970-7975992 GCTGTGTGCTTAAGAACAAAGGG - Intergenic
1172634122 20:36398214-36398236 GGTGTGTTAGAGAGAACCAAGGG + Intronic
1173988510 20:47281485-47281507 GCTGTGTGCTTGAGAACAACAGG - Intronic
1174036078 20:47669087-47669109 GATGTGAACAAGTGAACAAAGGG - Intronic
1174729222 20:52898408-52898430 GATATGTTCTAGAAAAGAATAGG + Intergenic
1174754308 20:53142541-53142563 GATGTTCTCTAGAGAAAAAGTGG + Intronic
1175508640 20:59505919-59505941 GATGCTTTACAGAGAACAAAGGG + Intergenic
1175907608 20:62388830-62388852 GATGTGTTCTAGAGAATGACAGG + Exonic
1177169884 21:17643336-17643358 AATATGCCCTAGAGAACAAAAGG + Intergenic
1178624320 21:34202623-34202645 GGTGGGTCCTAGAGAGCAAAGGG + Intergenic
1180717573 22:17882168-17882190 GATGTGTTTCTGAGATCAAAAGG + Intronic
1182546396 22:31079242-31079264 GGGGTGATCTAGAGATCAAAGGG - Intronic
1183853765 22:40614957-40614979 GGTGTCTTCTAAAGAACAGAAGG + Intronic
1185190419 22:49432865-49432887 GTTATGACCTAGAGAACAAATGG - Intronic
949263982 3:2135764-2135786 GATTTGTTGTTCAGAACAAATGG + Intronic
949309908 3:2685762-2685784 GATGTGATTTAAATAACAAAGGG - Intronic
949843748 3:8350053-8350075 GATGTATTGTGGAAAACAAAAGG + Intergenic
950315333 3:11996946-11996968 GCTGTTTTCAAGAGAAGAAATGG + Intergenic
951093254 3:18599446-18599468 GTTGTTTTCTAGAGAAGAATGGG - Intergenic
951171843 3:19551569-19551591 AATGTGTACTATAGACCAAATGG - Intergenic
951280224 3:20739172-20739194 TATTTGTTCTAGAGAAAGAAAGG + Intergenic
953488957 3:43331151-43331173 GAAGTATTCTAGACCACAAAAGG - Intronic
955011589 3:55021871-55021893 GATGTGTTATACAGACCACAAGG - Intronic
955309506 3:57871338-57871360 GTTGAGTTCTAGTGGACAAAAGG + Intronic
955800582 3:62681924-62681946 GAGGTCCTCTGGAGAACAAAAGG - Intronic
955809788 3:62775610-62775632 GATGTTTTCTAGAAAGTAAATGG - Intronic
956237213 3:67086696-67086718 GATCTGTGCTATAGACCAAATGG + Intergenic
957166938 3:76686593-76686615 AATATGATCTTGAGAACAAATGG - Intronic
957302068 3:78405089-78405111 GATGTATTCTAGAAAAGATAAGG - Intergenic
957606881 3:82411205-82411227 AATTTGTCCAAGAGAACAAAGGG - Intergenic
959080339 3:101794246-101794268 GATGAGATCTAGAGCACAGATGG + Intronic
959477855 3:106833411-106833433 GATATGTTAGAGAGAACAACAGG - Intergenic
959574057 3:107914991-107915013 AATGTGTTGTAGAAAAAAAATGG - Intergenic
960124403 3:113982709-113982731 AATATATTCTAGAGCACAAAGGG - Intronic
961226851 3:125257587-125257609 TATGTGCTCTGGAGAAGAAAGGG - Intronic
961833198 3:129635299-129635321 GGTGCATTCCAGAGAACAAAGGG + Intergenic
963231444 3:142912047-142912069 GCTGTGTTCTAAATTACAAAAGG - Intergenic
963766795 3:149345133-149345155 GATGTGTTCTAAGGACAAAAGGG + Intergenic
966220375 3:177545364-177545386 AATGTGTTCTAGAAAAGAGAAGG - Intergenic
966356577 3:179086106-179086128 CATGTGTTCTGGAGAATAACTGG + Intergenic
966472628 3:180308511-180308533 GAAGTATTCTAAAGAAAAAACGG + Intergenic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
970239364 4:13992324-13992346 TCTGTGTTTTAGAGAACAGAAGG + Intergenic
970582847 4:17489257-17489279 GATGTGATCTCTAGAACAAAAGG + Intronic
970586734 4:17521656-17521678 GGTGTATTCCAGAGAAGAAAGGG + Intronic
970805562 4:20026439-20026461 GATGTGGACAATAGAACAAAAGG - Intergenic
972400368 4:38696296-38696318 CAAGGCTTCTAGAGAACAAAGGG + Intronic
972808264 4:42553968-42553990 GATGTGTTTTAGAAAATAAAAGG + Intronic
973927847 4:55757816-55757838 GGTGTGTTCCAGAGAACAAAGGG - Intergenic
974140441 4:57879893-57879915 GCTGTGTTCTGGAACACAAAAGG - Intergenic
974504604 4:62752475-62752497 TATGTGTTCTATAGAAATAAAGG + Intergenic
975430349 4:74282675-74282697 AATGCGTTCTAGAGACAAAATGG + Intronic
975686959 4:76926109-76926131 GATGTTTTCTATAGCACAAGAGG - Intergenic
977725511 4:100292221-100292243 GATGTGATCTAGCGAAAAAGTGG - Intergenic
978659946 4:111113749-111113771 ACTATGTGCTAGAGAACAAAAGG - Intergenic
979918624 4:126471856-126471878 CTTGAGTTCTAGAGAAAAAAGGG + Intergenic
980432283 4:132717828-132717850 AATGTGTTGCAGAGAACAAAGGG - Intergenic
980647152 4:135656915-135656937 GATGTGTTTTAAAGAACTAGAGG + Intergenic
981199346 4:141961555-141961577 GAGGAGATGTAGAGAACAAATGG + Intergenic
981468600 4:145102457-145102479 AATGTCTTCTAGTGTACAAATGG + Intronic
982976546 4:162069165-162069187 GATGTGTTATAGAAAATCAAAGG - Intronic
984172463 4:176376940-176376962 AAACTGTTCTAGAGAAAAAAAGG + Intergenic
984480674 4:180297410-180297432 GCTGTGTTCCAGAGAGCAGAGGG + Intergenic
984509348 4:180659738-180659760 GATTTTTTCTAAGGAACAAAGGG + Intergenic
985981950 5:3477434-3477456 GATGGCTTCTAGAGAACACTGGG - Intergenic
987377994 5:17255211-17255233 GATTTCTTCTAGAAAATAAATGG - Intronic
987870584 5:23612072-23612094 AATCTGTGCTATAGAACAAATGG - Intergenic
988200264 5:28059543-28059565 GAAGTGTTCAAGAGAACAGAAGG + Intergenic
989373641 5:40736107-40736129 GATGGGGTCTAGAGTACAAGTGG + Intronic
990299117 5:54432915-54432937 GATGTGTTCTTTAGAATTAATGG + Intergenic
990462210 5:56039758-56039780 GCGGTGTTCCAGAGAACAAGAGG - Intergenic
991359079 5:65801645-65801667 AATGTCTTCTAAAGAACAAAAGG - Intronic
992262456 5:74984928-74984950 GGAGTGCTCCAGAGAACAAAGGG + Intergenic
992266816 5:75026908-75026930 AATGAGTTCAAGAGAAGAAAGGG + Exonic
993290756 5:86066787-86066809 GATGTGTTCCTGAGAAAATATGG - Intergenic
993359066 5:86950751-86950773 GATGTGTCATATAGAATAAAGGG + Intergenic
993745739 5:91594558-91594580 GATGATTTATAGACAACAAAAGG + Intergenic
994113055 5:96030345-96030367 GATTGGTGCTAGAGCACAAATGG - Intergenic
996583735 5:125061873-125061895 AATGTATTCTTAAGAACAAAAGG - Intergenic
996621602 5:125511088-125511110 GATGCATGCTAAAGAACAAAGGG - Intergenic
998355597 5:141533190-141533212 CATGTGTTCCAGAGATGAAAGGG - Intronic
998924625 5:147108361-147108383 GATATGATCTATAGAAAAAATGG + Intergenic
998930453 5:147175609-147175631 GATTGGTTCTAAAGATCAAAAGG - Intergenic
1001257979 5:170199722-170199744 GATATCTTCTAGAGAAAAGATGG - Intergenic
1001711305 5:173780566-173780588 GGTGTGCTTTGGAGAACAAAAGG - Intergenic
1004101183 6:12613421-12613443 TATGTATTGTAGAGAAGAAATGG - Intergenic
1005279604 6:24258924-24258946 GATGTGTTCTAGAGAACAAAGGG - Intronic
1006334135 6:33411509-33411531 GATGTTTTCCAGAGCAGAAACGG - Intronic
1006709178 6:36050687-36050709 GAGGTATTTTATAGAACAAACGG + Intronic
1007488371 6:42198313-42198335 GATGTGATCTAGGAAACAAGTGG - Intergenic
1007736848 6:43987284-43987306 GAGGTGTTCTAGAGAAGGAAGGG + Intergenic
1009350759 6:62675238-62675260 GACGTGTTTTAGAGCACAAAGGG + Intergenic
1009717704 6:67422204-67422226 GATGTGTTTTCTGGAACAAAAGG + Intergenic
1009743293 6:67776933-67776955 GATGTGGTCTAGTGCCCAAAAGG - Intergenic
1010638739 6:78294696-78294718 AATTTGTACTAGAGACCAAATGG + Intergenic
1010824598 6:80456829-80456851 CATGTGTTTCAGAGAAAAAAAGG + Intergenic
1011058139 6:83229444-83229466 GATGTTTACTAGATAACACATGG - Intronic
1012144149 6:95660429-95660451 GATTTGGTCTAGAGAATACATGG + Intergenic
1013135368 6:107277145-107277167 GATGAGGTCTACAGAAAAAAAGG - Intronic
1013969668 6:116001732-116001754 GATGCATTCCAGAGAACAAAGGG - Intronic
1014052895 6:116976367-116976389 GAGGTGTTCTAGCCTACAAATGG + Intergenic
1014321300 6:119931165-119931187 TATGTGCTATAGAGAACAGACGG - Intergenic
1016241095 6:141931849-141931871 GATATGAGCAAGAGAACAAAAGG + Intergenic
1017565431 6:155679806-155679828 GATGTCTGCTAGGGGACAAAGGG + Intergenic
1018472843 6:164111911-164111933 GCTGTGGACTAAAGAACAAAAGG + Intergenic
1020103858 7:5411663-5411685 GATGTGCTCTACAGAAAGAAGGG + Intronic
1020379061 7:7522333-7522355 GATGTGTTATATAGAAGAGAAGG - Intronic
1021353988 7:19631108-19631130 GATTTGTACTATAGACCAAATGG + Intergenic
1024368804 7:48556316-48556338 AATCTGTACTATAGAACAAATGG - Intronic
1026358078 7:69577254-69577276 TATGTGTTCTAGAAAACAAAAGG - Intergenic
1027613291 7:80389816-80389838 GATATGGTCTAGAGCACAAAAGG - Intronic
1027825159 7:83104056-83104078 TATATGTTTTAGAGAATAAAAGG - Intronic
1032498065 7:132377737-132377759 GATATCTTCTGGAGAGCAAAGGG - Intronic
1034041734 7:147884895-147884917 GATGTGTTATAAACAAAAAAAGG + Intronic
1034078284 7:148253243-148253265 GATGTGTTTTGGAAAAAAAATGG - Intronic
1034251659 7:149696594-149696616 GATGCCTTCCAGAGACCAAAAGG - Intergenic
1035380497 7:158437329-158437351 GATATGTTCAAGAAAATAAAGGG - Intronic
1035960581 8:4132561-4132583 GATGTATGCTATAGCACAAAGGG - Intronic
1042214987 8:66422091-66422113 GATGTGTTCTAAAAAATAATGGG + Intergenic
1043378113 8:79672511-79672533 GATGGGATCTAGTGTACAAAAGG - Intergenic
1045732077 8:105254405-105254427 AATCTGTCCTACAGAACAAATGG - Intronic
1046188282 8:110752187-110752209 TATGTGTTTGAGAGAAAAAAAGG - Intergenic
1046332903 8:112744995-112745017 GATGTGTTTGAGGGGACAAACGG + Intronic
1046368346 8:113268232-113268254 TATGTGTTCTGTGGAACAAAGGG - Intronic
1049021353 8:139959615-139959637 GCTTTGTTATAGGGAACAAATGG + Intronic
1050656527 9:7834483-7834505 GGTGTGTGCTAGAGAACAAAAGG - Intronic
1052553530 9:29984327-29984349 TATTTTTTCAAGAGAACAAAGGG + Intergenic
1052754185 9:32524081-32524103 GATGTCTACTAGAGTCCAAAGGG - Intronic
1053469415 9:38335530-38335552 GAGGTGTTCTGGAGTAAAAACGG + Intergenic
1058093487 9:100832406-100832428 GCTGTGTTCCAGAGAATAAAGGG + Intergenic
1058373105 9:104293003-104293025 GAAGTGTACTAGACAAAAAAAGG - Intergenic
1059610549 9:115887877-115887899 CCTGTGTTCTAGAAAACATAGGG + Intergenic
1059776738 9:117483633-117483655 GATGCCTTCTAGAGAGCAGAGGG - Intergenic
1061141445 9:128769904-128769926 GATTTGTTTTAGATGACAAATGG - Intronic
1062141819 9:134963393-134963415 GATGAGTTGGAGAGAAAAAAAGG - Intergenic
1190791794 X:53707382-53707404 GGTGCATTCCAGAGAACAAAAGG - Intergenic
1191860390 X:65661692-65661714 GATGTGTTCTTGAGAAAAACTGG - Intronic
1193335223 X:80280162-80280184 GATCTGGTCTTCAGAACAAAAGG + Intergenic
1193927907 X:87512745-87512767 GAGGTGGTCAAGAGTACAAAAGG + Intergenic
1194338455 X:92679357-92679379 AATCTGTACTATAGAACAAATGG - Intergenic
1195297366 X:103492263-103492285 GGTGTGTTCCAGAGGACAAAGGG + Intergenic
1195601515 X:106754077-106754099 AATGTGCAGTAGAGAACAAATGG + Intronic
1195703763 X:107723941-107723963 GAGGTTCTCTAGGGAACAAAAGG + Intronic
1196292959 X:113965516-113965538 GAAGTGGTCCAGAGAACAAAGGG - Intergenic
1196361927 X:114871435-114871457 AATCTGTTCTACAGACCAAATGG - Intronic
1197020757 X:121685145-121685167 GGTGAATTCCAGAGAACAAAGGG - Intergenic
1199489468 X:148382442-148382464 GATGTATTTTAGAGTATAAATGG - Intergenic
1200646859 Y:5796140-5796162 AATCTGTACTATAGAACAAATGG - Intergenic