ID: 1005285942

View in Genome Browser
Species Human (GRCh38)
Location 6:24326952-24326974
Sequence CAAAGTGAGCCCATCTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005285942 Original CRISPR CAAAGTGAGCCCATCTATCT GGG (reversed) Intronic
900976459 1:6019877-6019899 CGAAGTGAGTCCCTCTGTCTAGG - Intronic
902274470 1:15329411-15329433 CCAGGTGAGCCCACCTGTCTCGG + Exonic
904048064 1:27621194-27621216 CAAATGCAGCCCAACTATCTGGG + Intronic
907239971 1:53075929-53075951 AAAGGTGAGCCCATAGATCTTGG - Exonic
907622752 1:55998211-55998233 AAAAGTAAGCCTATCCATCTTGG + Intergenic
908166779 1:61466877-61466899 CCAGGTGAGGCCATCTCTCTGGG + Intergenic
908166950 1:61468278-61468300 CCAGGTGAGGCCATCTCTCTGGG - Intergenic
914212403 1:145592084-145592106 AAATGTGTGACCATCTATCTTGG + Intergenic
914790039 1:150869560-150869582 CAGAGTGAGCCCCTGTCTCTAGG - Intronic
917319681 1:173766622-173766644 CAAAGTGAGACCCTGTATCAAGG + Intronic
918084802 1:181236631-181236653 CAAAGAGAGGCCTTCTTTCTAGG + Intergenic
920209077 1:204315008-204315030 CAGAGTGAACCCACATATCTTGG - Intronic
924615341 1:245607564-245607586 GAAAGTGAGCCCACCTTCCTGGG - Intronic
1063572741 10:7231201-7231223 CACAATGATCCCATCTGTCTGGG + Intronic
1066612712 10:37266501-37266523 CAAACTAAGCCCATTTGTCTAGG + Intronic
1070000011 10:72369281-72369303 CACAGTGAGACCATGTCTCTTGG + Intronic
1070027378 10:72645012-72645034 CAGAGTGAGGCCAGCTATTTAGG - Intergenic
1070574243 10:77665496-77665518 CCATGTGAGCCCATCTAAGTAGG + Intergenic
1072633040 10:97159902-97159924 CAAAGTCAGCAAACCTATCTTGG - Intronic
1074172305 10:110953928-110953950 CTAAGTGAAGTCATCTATCTTGG + Intronic
1074491076 10:113940224-113940246 GAAAGGAAGCCCATCTGTCTGGG - Intergenic
1076877182 10:133221598-133221620 CCAAGTGAGGCCATCTACCGTGG - Intronic
1079154602 11:17933509-17933531 GAAAGTCACTCCATCTATCTGGG + Intronic
1079654341 11:22969688-22969710 AAAAGAGAGCCCAAATATCTAGG - Intergenic
1080566803 11:33517213-33517235 AAGTGTGAACCCATCTATCTTGG - Intergenic
1090294105 11:125571003-125571025 CGAAGTGAGCCTATCTGTGTAGG + Intronic
1090847100 11:130538965-130538987 CAAAAAGAGCCCATATAGCTAGG - Intergenic
1093594378 12:20943809-20943831 CAAAGTAAGCCCACCCAACTAGG - Intergenic
1098403001 12:70093504-70093526 TCAAGTGATCCCATCTGTCTCGG - Intergenic
1098748061 12:74265313-74265335 CAAAGTAAGCCCATCCCACTAGG + Intergenic
1100285435 12:93161439-93161461 TAAAGTGAGCCTTCCTATCTTGG + Intergenic
1101230710 12:102738148-102738170 CAAAGTGAGCCCCGGGATCTAGG - Intergenic
1104520604 12:129471281-129471303 CAAAGTGAGCACATGTTGCTGGG - Intronic
1110536571 13:76657808-76657830 CAAACTGAGCACATATATGTGGG - Intergenic
1114529294 14:23385831-23385853 CTAAGTGAGCACATCTAGCCAGG - Intronic
1115278113 14:31631031-31631053 CAAACAGAGCCCATTCATCTTGG - Intronic
1115306030 14:31934580-31934602 CAAAGTGATCCCATTTATAATGG + Intergenic
1115534842 14:34363359-34363381 CAAAGTGACCCCAGGTATCAAGG - Intronic
1119585433 14:75830264-75830286 CAAAGTGAGCACCTGCATCTGGG + Intronic
1130698956 15:86159742-86159764 CCAAATGATCCCATCTATCTTGG - Intronic
1133506320 16:6415892-6415914 CAAAGTGAACCCATCTTACCTGG - Intronic
1134384742 16:13761087-13761109 CAAAGTGCGCCCATTTTTTTAGG - Intergenic
1137352768 16:47728308-47728330 CAAGGTGAGGCCATCCAGCTTGG + Intergenic
1140816347 16:78624578-78624600 CATACTGAACCCATCTAACTTGG + Intronic
1144095267 17:11894644-11894666 CACAGTGAGCTCATCTTTCCTGG + Intronic
1147048115 17:37769863-37769885 CAAACTGACCCCATTTTTCTGGG - Intergenic
1153337917 18:3943675-3943697 CTAAATGAGACCATCTATTTGGG + Intronic
1154229914 18:12546582-12546604 CAGAGTGAGACCATCTCTCCAGG + Intronic
1159938112 18:74384725-74384747 CAGACAGAGCCCATCTATCAAGG - Intergenic
1165472510 19:36011423-36011445 CAAAGTGGACCCAGCTCTCTGGG - Exonic
924987144 2:282224-282246 CATAGAGAGCACATCTATATAGG + Intronic
925625265 2:5836561-5836583 CAGAGTGAGACCCTCAATCTGGG + Intergenic
932028843 2:68162555-68162577 TAAAGGGAGACCATCTATCCAGG + Exonic
937271874 2:120658108-120658130 CAAGTTGAGCCCATCCATATTGG - Intergenic
938092836 2:128444553-128444575 CAAAGAGAGCCCATCTGGCCTGG + Intergenic
940037484 2:149326112-149326134 CAAAGTGAGCACATGTTTTTGGG + Intergenic
941496334 2:166209154-166209176 CAAAGTCAGTCCATAAATCTTGG + Intronic
948243714 2:236460549-236460571 CAAAGAAAGGCCATCTATTTGGG - Intronic
948988421 2:241539992-241540014 CACAGTGGGCCCACCCATCTTGG + Intergenic
1172433409 20:34911554-34911576 CAAAGTGGGCCCATCTATTGAGG - Intronic
1173725933 20:45297899-45297921 CCAGGTGAGCGCATCTCTCTCGG - Exonic
1173878386 20:46391611-46391633 CAAAGTGATTCCCTCTACCTGGG + Intronic
1175514065 20:59557606-59557628 CAAAGTAAGCCCACCCCTCTAGG - Intergenic
1177431085 21:20993116-20993138 GAAAATGACCCCATGTATCTTGG + Intergenic
1184100700 22:42340539-42340561 CAGACTGAGTCCATCTGTCTGGG - Intronic
1184867277 22:47208713-47208735 CAAATTCACTCCATCTATCTCGG + Intergenic
950039001 3:9907698-9907720 CAAAATGATCACATCTGTCTTGG + Intronic
950437457 3:12988897-12988919 CAAGATGAGCCCTTCTAGCTCGG - Intronic
951166549 3:19489652-19489674 CAAAGTGAGCCCATCCCACTAGG - Intronic
952136458 3:30427778-30427800 CAATGTCTGCCCTTCTATCTGGG + Intergenic
959153174 3:102632098-102632120 CAAAGTGAGACCTTGTCTCTGGG - Intergenic
960823820 3:121761511-121761533 GAGACTGAGCCCACCTATCTTGG - Intergenic
963967159 3:151385694-151385716 CAAAGTGAGACCCTGTCTCTGGG + Intronic
964522972 3:157586967-157586989 CAAAGTAAGCCCATCCCACTAGG - Intronic
965912765 3:173801278-173801300 TAAAGTGAGCTCATCTTTTTTGG + Intronic
966325628 3:178750582-178750604 CAAAGTGACTCCTTCTACCTAGG - Intronic
968298115 3:197592863-197592885 CATAGTGAGTCCATCTAGCTAGG + Intergenic
968330749 3:197867481-197867503 TCAAGTGATCCCATCTACCTCGG - Intronic
969843644 4:9902107-9902129 CCAGGTGAGCCCAGCTGTCTGGG - Intronic
977960365 4:103077834-103077856 CCAAGTCACCCAATCTATCTTGG - Intronic
982676090 4:158377357-158377379 TAAATTGAGCTCATCTAACTGGG + Intronic
984229372 4:177075579-177075601 CAAAGTGAGAACTTCTATCCCGG - Intergenic
986307762 5:6528437-6528459 AAAAGTCAGCCCCTCTTTCTAGG + Intergenic
987628899 5:20442066-20442088 CATAGTTAGTCCCTCTATCTAGG + Intronic
987932771 5:24424052-24424074 TAAAATGATCTCATCTATCTTGG - Intergenic
988881144 5:35504226-35504248 CAAAGCCAGCCCATATAACTGGG + Intergenic
992184620 5:74232175-74232197 AAAAGTGATTCCATCTGTCTTGG + Intergenic
993641499 5:90410880-90410902 CAAATTTAGCCCATCCTTCTAGG - Intergenic
993760572 5:91791627-91791649 CAGAGTGAGCCCATTTTCCTAGG - Intergenic
994060580 5:95472335-95472357 GAAAGTGATCCCATGTTTCTGGG - Intronic
994554491 5:101281083-101281105 CAAAGTGAGATTATATATCTAGG + Intergenic
995355051 5:111227693-111227715 GAAAGTGAGCACATCTGTCTTGG - Intronic
1002463267 5:179387481-179387503 CAAAGTGAGCCCCACAGTCTAGG - Intergenic
1004522062 6:16371061-16371083 CAAATTGAGCCCATCTCTACTGG - Intronic
1005285942 6:24326952-24326974 CAAAGTGAGCCCATCTATCTGGG - Intronic
1008530540 6:52453838-52453860 CAAAGTGAGCTCTTCTTTTTTGG + Intronic
1014950836 6:127553181-127553203 TAATGTTAGCCCATCTGTCTAGG - Intronic
1021420285 7:20439266-20439288 CAAAGTAAACCCAACTCTCTGGG + Intergenic
1023070564 7:36428036-36428058 CAAAGTCACCTCATCTCTCTAGG + Intronic
1030925625 7:115450263-115450285 CCAAGTGTTGCCATCTATCTGGG + Intergenic
1032705614 7:134419043-134419065 CAAAGTGACCCAGTGTATCTGGG - Intergenic
1035222773 7:157415888-157415910 CAAAATGAAGTCATCTATCTTGG - Intronic
1038325302 8:26568258-26568280 CAAACTGTGCCCCTCTACCTAGG - Intronic
1039191478 8:34981115-34981137 CCAAGTGTGCCCATGTTTCTTGG - Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1040397879 8:47016684-47016706 CAGAGTGAGGACATCTTTCTTGG + Intergenic
1041906210 8:63036565-63036587 GAAGGAGAGCCCATCTATGTAGG + Intronic
1042912122 8:73838555-73838577 CAAAGTGAGACCACGTCTCTAGG + Intronic
1044743385 8:95350071-95350093 CAAAGTGAGCAGATCTAGCCTGG + Intergenic
1044758996 8:95496909-95496931 CAAAGAGAGTCCAACCATCTGGG - Intergenic
1044925682 8:97206807-97206829 CAAATGCAGCCCCTCTATCTTGG - Intergenic
1051996873 9:23227997-23228019 CAAAGAGAGCTCATTTATCAAGG + Intergenic
1052284318 9:26767820-26767842 TAAAGGCAGCCCATCTATTTTGG + Intergenic
1060217141 9:121745227-121745249 CACAGTGAGCCCACATACCTGGG - Intronic
1186646775 X:11515158-11515180 CAATGTAAGACAATCTATCTTGG - Intronic
1190268414 X:48843683-48843705 TAAAGTGACCCCATCAATGTTGG - Intergenic
1190426409 X:50337678-50337700 CAAAGTAAGCCCACCTCACTAGG - Intronic
1192678670 X:73228320-73228342 CAAAGACAGCCCCTCTATATTGG + Intergenic
1194548959 X:95272933-95272955 CAATGTCAGGCCATCTCTCTCGG + Intergenic
1200183140 X:154163597-154163619 CAGAGTGAGCTCATCCATCCTGG - Intergenic
1200188794 X:154200711-154200733 CAGAGTGAGCTCATCCATCCTGG - Intergenic
1200194444 X:154237852-154237874 CAGAGTGAGCTCATCCATCCTGG - Intergenic
1200200199 X:154275655-154275677 CAGAGTGAGCTCATCCATCCTGG - Intronic