ID: 1005286180

View in Genome Browser
Species Human (GRCh38)
Location 6:24329476-24329498
Sequence CTGCAATCCCAAAATTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005286175_1005286180 17 Left 1005286175 6:24329436-24329458 CCATTGCTATCCTATTTCATTTC 0: 1
1: 0
2: 2
3: 38
4: 553
Right 1005286180 6:24329476-24329498 CTGCAATCCCAAAATTATAATGG 0: 1
1: 0
2: 1
3: 21
4: 223
1005286177_1005286180 -10 Left 1005286177 6:24329463-24329485 CCTCATTTTCACCCTGCAATCCC 0: 1
1: 0
2: 1
3: 30
4: 362
Right 1005286180 6:24329476-24329498 CTGCAATCCCAAAATTATAATGG 0: 1
1: 0
2: 1
3: 21
4: 223
1005286176_1005286180 7 Left 1005286176 6:24329446-24329468 CCTATTTCATTTCAACTCCTCAT 0: 1
1: 0
2: 3
3: 41
4: 337
Right 1005286180 6:24329476-24329498 CTGCAATCCCAAAATTATAATGG 0: 1
1: 0
2: 1
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005286180 Original CRISPR CTGCAATCCCAAAATTATAA TGG Intronic
901571012 1:10160687-10160709 CTGTAATCCCAACATTTTGAGGG + Intronic
902885989 1:19405175-19405197 CTGCTATCCCCAAATTCTGAGGG - Intronic
905098846 1:35500464-35500486 TTGCAATTCCAAAAGTAGAAAGG - Intronic
910047974 1:82940368-82940390 CTGCAATTTGAAAAATATAAAGG - Intergenic
910624507 1:89292200-89292222 CTACATTCCCTAAATTATTAAGG + Intergenic
910671905 1:89782133-89782155 CCTCAATCCCAAAGTTATAAAGG + Intronic
913486819 1:119339496-119339518 CTCAAATCCCAAAATTTAAAAGG - Intergenic
915395910 1:155583930-155583952 CTGAAATCCCACAAGTAAAAAGG + Intergenic
916165833 1:161966609-161966631 CTGCAGACCCAAAATTGAAATGG + Intergenic
919113072 1:193244113-193244135 CTGCAATCCCTTTATTATCAAGG - Intronic
920742088 1:208590581-208590603 CTCCCATCCCCAAATTATACAGG - Intergenic
921012542 1:211157201-211157223 CTGCAATCCCATCATTTTAAGGG + Intergenic
921622639 1:217343023-217343045 CTGAAGTCACAAAATTATAAGGG - Intergenic
922013390 1:221615915-221615937 ATGTAATCTCTAAATTATAATGG + Intergenic
922829404 1:228543923-228543945 GTGCAATTCCAAATTTCTAATGG - Intergenic
1065227119 10:23555550-23555572 CAGAAAACCCAATATTATAAAGG - Intergenic
1065655259 10:27941853-27941875 CACCAATCTCAAATTTATAAGGG + Intronic
1066560688 10:36666458-36666480 CTGCAATACTAAAATAATAGGGG + Intergenic
1068361782 10:55983763-55983785 CTTCAACCCTAAAATTAAAAAGG - Intergenic
1068611891 10:59069472-59069494 CTGCACTAGCAAAATTCTAATGG - Intergenic
1070810813 10:79296899-79296921 CGGCACTCACAAAATAATAAAGG + Intronic
1072141424 10:92592285-92592307 CTGTAATCCCAACACTTTAACGG - Intergenic
1074010884 10:109478280-109478302 TTGCAAACACAAAATTATACAGG - Intergenic
1075107861 10:119554049-119554071 CTGCAATCCCAACATTTTGTGGG - Intergenic
1076713163 10:132350219-132350241 CTGAAATCCCAAAATTATATTGG + Intronic
1078229287 11:9424787-9424809 CTGCTTTTGCAAAATTATAAAGG + Intronic
1079367776 11:19824320-19824342 CTGCAACCACAAAATCATAAAGG - Intronic
1081740252 11:45434578-45434600 CTGCCATCCCTAACTTATGAAGG - Intergenic
1083247776 11:61443010-61443032 CTGTAATCCCAACACTTTAAGGG - Intronic
1084841517 11:71854971-71854993 ATGCAAACCTAAAATTATTAAGG + Intergenic
1085817196 11:79751891-79751913 ATGCAATCCTAAAATTAATATGG + Intergenic
1086342567 11:85861351-85861373 CTGCAGTTCCCAAATTATACTGG - Intronic
1086766964 11:90707512-90707534 ATGGAATCCCAAGTTTATAATGG + Intergenic
1086902780 11:92386498-92386520 CTGCAATCATAAAAGCATAAAGG + Intronic
1090876211 11:130790863-130790885 CTGCAAACTCAAAATTAAGAAGG - Intergenic
1091566698 12:1654080-1654102 CTGCAATCCCAAGATTTTGGGGG + Intergenic
1094414590 12:30203246-30203268 CTGCCATCCCAATTTTAAAACGG + Intergenic
1095389966 12:41694232-41694254 CTGCAATGCCATACTTAAAAGGG - Intergenic
1095443615 12:42262586-42262608 CTGCAATCATAAAAGTAAAAAGG - Intronic
1096423154 12:51477869-51477891 CTGTAATCCCAGCATTTTAAGGG + Intronic
1098355753 12:69610928-69610950 ATGCAATCCCCAAGTTATAATGG - Exonic
1098390329 12:69963088-69963110 TTGAAATCCAAAAATTATATAGG - Intergenic
1098540464 12:71650684-71650706 CAGAAATCCCAAAATTTCAAGGG + Intronic
1100371736 12:93975006-93975028 CTGAAATCCCAAGATTAAGAGGG + Intergenic
1100729391 12:97447371-97447393 CTGCAATTCCAGAATTAGAGAGG + Intergenic
1101076668 12:101136864-101136886 CTCCAATCCCAGAATTGAAAAGG + Intergenic
1101080759 12:101181327-101181349 TTGAATTCCCAAAATTATAATGG - Intronic
1102551783 12:113696624-113696646 CTGCAATCCCAATAGTACCAAGG - Intergenic
1105383252 13:19906814-19906836 CTGTAATCCCAAAACTAGGAGGG - Intergenic
1109729997 13:66400526-66400548 CTGCAAATGCAAATTTATAAAGG - Intronic
1112779302 13:102880760-102880782 CTGCAATCCTAAAATTTAAGAGG - Intergenic
1113189724 13:107730345-107730367 CTGTAATACAAAAATTATACAGG + Intronic
1113353732 13:109556313-109556335 CTGCAATGCAATAATAATAAGGG + Intergenic
1114281666 14:21198115-21198137 CTTCAATCCCCAAATTCTCAGGG + Intergenic
1114601794 14:23961768-23961790 CTGCAATCCCAATATTTTGGGGG - Intronic
1114858335 14:26482100-26482122 CTGCAATCTGAAAAGTATAGGGG - Intronic
1119957182 14:78811183-78811205 AAGCAATCCCAACATTATAATGG + Intronic
1120704944 14:87736054-87736076 CTGCAATCCCCAAATCCCAAAGG + Intergenic
1123677081 15:22721096-22721118 CTTCCCTCCCAAAATTCTAAAGG - Intergenic
1124117007 15:26853989-26854011 CTGCAATACCAAAATCTAAATGG - Intronic
1125281163 15:38043780-38043802 CTTCAATGCCAAAATTCTACTGG - Intergenic
1126593203 15:50360055-50360077 CTGTAATAGCTAAATTATAATGG + Intergenic
1129818504 15:78577975-78577997 CTGAAATACCAAAAATTTAAGGG - Intronic
1131006012 15:88979147-88979169 CTGTAATCCCAAAATTTGAGAGG + Intergenic
1132181542 15:99756785-99756807 CTGCAATCCCCATAGTAGAATGG + Intergenic
1133385599 16:5367724-5367746 TTTCAATCTCAAGATTATAATGG - Intergenic
1135517227 16:23146288-23146310 CTGAGATCTCAAAATTAGAAAGG - Intronic
1135957626 16:26969508-26969530 CTGCAATCACATATTAATAAAGG + Intergenic
1137479811 16:48842914-48842936 CTGCAATGACAAAAATAGAAAGG - Intergenic
1137872703 16:51966063-51966085 CTGAAATCCCAAGAATTTAAAGG - Intergenic
1139709589 16:68765597-68765619 ATGAAATCCCAAAATTGTAGGGG + Intronic
1139743069 16:69052209-69052231 CTGCAATCCCAACATCATTTTGG - Intronic
1140972357 16:80025506-80025528 CTCCATGCCCAAAAATATAAAGG - Intergenic
1141215682 16:82021089-82021111 CTGCAATTCCAAAAATGTAATGG - Intergenic
1141928478 16:87184724-87184746 CTGCAATCCCAGCATTTTAGGGG + Intronic
1142543156 17:677860-677882 CTGTAATCCCAACATTTAAAAGG + Intronic
1144516579 17:15921755-15921777 CTGAATTCACAAAATTATTAGGG + Intergenic
1144862183 17:18312005-18312027 ATCCAATGCCAAAATTATTAGGG - Intronic
1145178847 17:20726985-20727007 CTGTAATCCCAAAACTTTAAAGG + Intergenic
1148503128 17:48107052-48107074 CTGTAATCCCAATACTATTAGGG - Intronic
1149838497 17:59936586-59936608 CTGTAATCCCCAAACTTTAAAGG + Intronic
1150080825 17:62236733-62236755 CTGTAATCCCCAAACTTTAAAGG - Intergenic
1153178626 18:2407482-2407504 CTGAAATACCAAAAGTATAAAGG - Intergenic
1155555741 18:27017455-27017477 CAACAATCTCAAAATTATTACGG + Intronic
1157463242 18:47920895-47920917 CTGTAATCCCAAAACTTTGAGGG + Intronic
1158359397 18:56654506-56654528 CTGAAACCCCAAAATAAAAATGG - Intronic
1158360646 18:56668646-56668668 CTTCCATCCCAAAACTAAAATGG - Intronic
1159326077 18:66919901-66919923 CTACAATATCAAAATTGTAAAGG - Intergenic
1159363236 18:67431993-67432015 CTGCAGTGCAAAAAATATAAGGG - Intergenic
1159644742 18:70904368-70904390 CTTCAATCACACAATTAAAATGG - Intergenic
1166021124 19:40030557-40030579 CTGTAATCCCCAACTTAAAATGG - Exonic
1166191318 19:41178777-41178799 CTGTAATCCCAACATTTTGAGGG + Intergenic
1167010759 19:46805843-46805865 CTGCCATGCAAAATTTATAAGGG + Intergenic
1167107817 19:47440972-47440994 CTGTAATCCCAAACTCATACAGG + Intronic
1167511031 19:49895456-49895478 CTGCAATCCGAGAATGAGAATGG - Intronic
1167614130 19:50522348-50522370 CTGCAATTCCAAAATTCTTAAGG + Intronic
925936727 2:8770511-8770533 ATACAACTCCAAAATTATAATGG + Intronic
926700865 2:15802437-15802459 CTGTAATCCCAGAATTTTGAGGG + Intergenic
929138463 2:38646718-38646740 CTGTAATCCCAACATTTTGACGG + Intergenic
930200006 2:48543787-48543809 CTGTAATCCCAAAACTTTGAGGG - Intronic
930453412 2:51574173-51574195 TTGCAATCCCAAAAGGATGAGGG + Intergenic
930798103 2:55414026-55414048 CTTCAAACCCAAAATTCTAAAGG + Intronic
930839310 2:55827487-55827509 CTCCAATCCCCAAATTCTCAGGG - Intergenic
931246253 2:60495059-60495081 GTGGACTCCCAAAATTGTAAAGG - Intronic
933125093 2:78594787-78594809 CTGCAATCCCAACACTTTGAGGG + Intergenic
935010382 2:99129668-99129690 CTGCAATCTCATCATTAGAATGG + Intronic
939363761 2:141206961-141206983 CTGCAATCCAAGAATTAGAAGGG - Intronic
939887200 2:147693939-147693961 CTGCTACCTCTAAATTATAATGG - Intergenic
941610296 2:167653535-167653557 CTGGAATCACAGAATTATCAAGG + Intergenic
942735751 2:179110883-179110905 CAGCAATTCCAAAATATTAAAGG + Intronic
942852599 2:180507613-180507635 GTGCCCTCACAAAATTATAAGGG - Intergenic
943654884 2:190498040-190498062 CTGTAATTCCAAAATTCTAGTGG + Intronic
945103321 2:206283918-206283940 CTGTAATCCCAAAATTTTCAGGG - Intronic
945797092 2:214378491-214378513 CAGCCTTCCCAAACTTATAAGGG - Intronic
946704041 2:222439732-222439754 TTGAAATGGCAAAATTATAAAGG + Intronic
1170725237 20:18920297-18920319 CTTCAATCCCTAAATTCTCAGGG + Intergenic
1171045587 20:21807256-21807278 CTGGAATCTCAAAAATATCAAGG + Intergenic
1172797924 20:37555767-37555789 GTGAAATCCCCAAATTACAATGG + Intergenic
1172826354 20:37790385-37790407 GTGCAAAAGCAAAATTATAATGG + Intronic
1173343017 20:42170535-42170557 ATGCAATACCAGAATTAAAATGG + Intronic
1174360446 20:50025755-50025777 CTGCAATCCCAACACTTTGAAGG - Intergenic
1177231669 21:18329140-18329162 CTGCAATCTGAATATTGTAAAGG - Intronic
1178194514 21:30328330-30328352 CTGCATTCCCGAAACTATGACGG + Intergenic
1178722952 21:35026459-35026481 CTGTAATGCCAAAATGAAAAGGG - Intronic
1180604840 22:17050139-17050161 CTGTAATCCCAAAACTTTAAAGG + Intergenic
1183514228 22:38254340-38254362 CTGTAATCCCAAAACTTTGAGGG + Intronic
949410647 3:3760237-3760259 ATGCCATCCCAGGATTATAAAGG - Intronic
949707645 3:6837389-6837411 CTGCAAACCCAAAAATATGTTGG - Intronic
950777526 3:15363458-15363480 CTGTAATCCCAACACTTTAAGGG - Intergenic
951877630 3:27444837-27444859 CTGGAATCCAAAAATTATCAGGG - Intronic
952174783 3:30850112-30850134 CTGCAAAAACAAAATTAAAATGG + Intronic
953346529 3:42180517-42180539 CTGCATTCCAAAAATTAGATAGG + Intronic
953940104 3:47087110-47087132 CTCCAAGCACAAAATTTTAACGG - Intronic
954461938 3:50632002-50632024 CTGGAATCCCAAGAAAATAAAGG + Intronic
954799690 3:53180153-53180175 CTGCCTTTCCAAAATTAAAAAGG - Intronic
955231171 3:57100019-57100041 CTGGAATCCCAAACTGATTAAGG - Intronic
956635458 3:71359690-71359712 CTACAATTCCAAAATTATTTGGG - Intronic
956951101 3:74283436-74283458 ATGCTATCCCTAAATTGTAAAGG + Intronic
957675609 3:83360186-83360208 CTTCAATTCCAATATCATAATGG - Intergenic
957789626 3:84922557-84922579 CTGATATCACAAAATTACAAAGG + Intergenic
957826436 3:85451534-85451556 CTGCAATCCCAATATCTTAAGGG - Intronic
957932113 3:86893628-86893650 GTGCAATGCCAACATTATGATGG + Intergenic
961419373 3:126788675-126788697 ATGCAATAAAAAAATTATAAAGG - Intronic
963586846 3:147202638-147202660 CTACAATGCCAATATTTTAATGG - Intergenic
964152999 3:153550377-153550399 CTCCAACACAAAAATTATAAAGG - Intergenic
964513949 3:157485990-157486012 TGGCAAACCCAAAATTATAATGG + Intronic
966629752 3:182059367-182059389 CTCGAATCCTAGAATTATAAAGG + Intergenic
969782613 4:9421010-9421032 ATGCAAACCTAAAATTATTAAGG + Intergenic
969906335 4:10399875-10399897 TAGCAATCCCATGATTATAATGG - Intergenic
970027781 4:11641779-11641801 TTGCATTCACAAAATTATAGAGG - Intergenic
970070831 4:12157988-12158010 ATGCAATAACAAAATGATAAAGG - Intergenic
972205881 4:36772189-36772211 CTCAAATCCCAAAACTCTAATGG + Intergenic
972332553 4:38077457-38077479 TTTCAACCCCAAAATTATTAAGG - Intronic
972435509 4:39030262-39030284 CTGCCTTCCCAAACTTAAAATGG - Intronic
975318826 4:72986190-72986212 CTGCAAGCTAAAAATTATGAAGG - Intergenic
977112118 4:92971091-92971113 CTGTAATCCCAACATTTTGAGGG - Intronic
977227641 4:94412197-94412219 CTGCAATTCCAAATTTTTACTGG + Intergenic
978307585 4:107348537-107348559 CTGCAATCCCTGAATTTTCAAGG + Intergenic
979885951 4:126028051-126028073 CTCTAATGACAAAATTATAATGG - Intergenic
980651751 4:135725993-135726015 CAGCAACCCCAAAATGAGAAGGG - Intergenic
983108137 4:163715784-163715806 CTCCAATCTCAAAAACATAAAGG + Intronic
983759056 4:171382797-171382819 CTGTAATCCCAAAATTAATGTGG + Intergenic
987648489 5:20708383-20708405 CTGGGCTCCCTAAATTATAAGGG - Intergenic
988115942 5:26891419-26891441 CTGTAATCCCAAAATTTTGGAGG + Intronic
988747844 5:34160532-34160554 CTGGGCTCCCTAAATTATAAGGG + Intergenic
988916426 5:35898780-35898802 CAGCAATGCAAAGATTATAAGGG - Intergenic
989072474 5:37525774-37525796 ATGCAATACAAAAATGATAAAGG + Intronic
989689665 5:44125972-44125994 CAACAATCCCAAAATTAACACGG + Intergenic
990314461 5:54571092-54571114 CTCCAATCCAGAAATCATAAAGG - Intergenic
990934469 5:61132933-61132955 CTCCAATCCCATAATAAGAAGGG + Intronic
991623864 5:68576881-68576903 CTGGATTCCAGAAATTATAAGGG - Intergenic
992392409 5:76341278-76341300 CTGTAATCCCAAAACTCTAGGGG + Intronic
992584831 5:78227371-78227393 ATGCAATACAAAAATTATACAGG - Exonic
992721157 5:79562494-79562516 TTGTATTCCTAAAATTATAATGG + Intergenic
993458696 5:88156936-88156958 CTGCAGCCTCAAATTTATAAGGG - Intergenic
993487392 5:88503759-88503781 CTGCAACTACAAAATAATAAGGG + Intergenic
994803238 5:104407098-104407120 CATCAATGCCAACATTATAAAGG + Intergenic
994832126 5:104797569-104797591 TTTCAATCCCAAAATTCTACTGG + Intergenic
994943734 5:106358917-106358939 CATCAATCCCAAAATAATAGGGG - Intergenic
996147643 5:119995397-119995419 TTGCAATCCTGAAATAATAAAGG - Intergenic
996205572 5:120731362-120731384 CAGCAATCCCCAAATTTTATTGG - Intergenic
996607587 5:125341998-125342020 CTGTAATCCCAACATTTTGAGGG - Intergenic
997622112 5:135305690-135305712 CTGCAATCCCAAAGGTGGAATGG + Intronic
998531228 5:142886810-142886832 ATGGAATCCCAAATTTATCATGG - Intronic
1000904747 5:166951405-166951427 CTGCCATCACAAAATTAAATTGG + Intergenic
1005286180 6:24329476-24329498 CTGCAATCCCAAAATTATAATGG + Intronic
1005364665 6:25064858-25064880 CTGCAACCCCAAAAGGATGATGG - Intergenic
1005545427 6:26863616-26863638 CTGGGCTCCCTAAATTATAAGGG + Intergenic
1006338803 6:33434599-33434621 CTGTAATCCCAACATTTCAAAGG - Intronic
1007025394 6:38567009-38567031 TTGCAACTCCAAAATTACAATGG + Intronic
1007490049 6:42213560-42213582 CTGTAATCCCAAACTGTTAAAGG + Intronic
1007981669 6:46165848-46165870 CTGCAATACCCAAATAAAAATGG + Intronic
1008189965 6:48442979-48443001 CTGATATCACAAAAATATAAAGG - Intergenic
1009016132 6:57904384-57904406 CTGGGCTCCCTAAATTATAAGGG + Intergenic
1009531839 6:64828293-64828315 CTGGAATCCCTAAAGTAAAAGGG + Intronic
1009535483 6:64877671-64877693 CTTTAATCCCAAGATTAAAATGG - Intronic
1009719147 6:67442565-67442587 CTGCTGTCTAAAAATTATAATGG - Intergenic
1011471293 6:87710367-87710389 CTGCAAGCCCATTGTTATAAGGG + Intergenic
1013446165 6:110229945-110229967 CTGAAATCACATAACTATAATGG - Exonic
1013547373 6:111171393-111171415 CTGCAATCCCAGCATTTTAGAGG + Intronic
1013879929 6:114885118-114885140 CTGCAAAACCAAAAATATGAGGG + Intergenic
1014059688 6:117056817-117056839 AAGCAATCCCAAAATTCTTATGG - Intergenic
1018712259 6:166505592-166505614 CGGCAAACACAAAATTAGAAGGG + Intronic
1028679021 7:93504057-93504079 ATGTAATTACAAAATTATAAAGG + Intronic
1029089406 7:98036397-98036419 CTAGAGTCTCAAAATTATAAAGG - Intergenic
1029293721 7:99522607-99522629 CTGTAATCCCAAAATTACTCGGG - Intronic
1030703753 7:112669397-112669419 CTGCTATCCCAAACCCATAATGG + Intergenic
1030762812 7:113372045-113372067 CTGGAATGCTAACATTATAAGGG - Intergenic
1030861294 7:114633751-114633773 CTGGAATCCCAAAACTAGAGTGG + Intronic
1031498018 7:122475501-122475523 GTACAATCTTAAAATTATAAAGG + Intronic
1032256465 7:130301051-130301073 CAGCAATCCAAGAATTAGAAAGG - Intronic
1032261954 7:130345504-130345526 CTGCTATTCCCAAACTATAAAGG + Exonic
1032637033 7:133720396-133720418 TTGCAATCTCATAATTATGAAGG - Intronic
1032753726 7:134868188-134868210 CTTCAATCTAAAAAATATAAAGG + Intronic
1035813633 8:2514706-2514728 CTGCAATCTTAAAAGTATAATGG + Intergenic
1037189978 8:16112890-16112912 CTACAACCCTCAAATTATAAAGG - Intronic
1037267643 8:17083606-17083628 CTGCCATTGCAAAATTATAATGG - Intronic
1039013588 8:33122500-33122522 CTCCAATCCCCAAATTTTCAGGG + Intergenic
1039416821 8:37402287-37402309 CTTAAAGTCCAAAATTATAAAGG + Intergenic
1039976938 8:42374870-42374892 ATGCAACCCCAATATTAGAAAGG - Exonic
1040002204 8:42587032-42587054 CTGCAAACCCAAAGTTATCTAGG + Intergenic
1040365033 8:46706448-46706470 CTGTATAACCAAAATTATAATGG - Intergenic
1040955609 8:52976973-52976995 CAGAAATTCCAAAATTACAAGGG - Intergenic
1045713403 8:105013000-105013022 CTGCTATCTAAAAATAATAAAGG + Intronic
1045856887 8:106774612-106774634 CTGCAATCCCATATTTATAGTGG - Intergenic
1046574931 8:116016169-116016191 CTGGAATCCCAAAAACAGAAGGG - Intergenic
1047043453 8:121024806-121024828 TTGCCACCCCAAAATTAGAATGG - Intergenic
1047826618 8:128583064-128583086 CTGTAAGCCCAAAATATTAATGG + Intergenic
1048411451 8:134178339-134178361 CTGTAAAGCCAAAATTATCAGGG - Intergenic
1049069046 8:140343090-140343112 CTGAAATTCAAAAAATATAAAGG + Intronic
1049111631 8:140648599-140648621 CTGTAATCCCAACATTTTAGGGG + Intergenic
1050351933 9:4748471-4748493 CTGTAATCCCAATATTTTAGAGG - Intergenic
1050835077 9:10067111-10067133 CTGCAATCCCAATTTTATCCTGG - Intronic
1051137371 9:13937564-13937586 ATGCTATCATAAAATTATAATGG - Intergenic
1051377525 9:16418758-16418780 CTCCTTTCCCAAAACTATAAAGG + Exonic
1052008358 9:23377424-23377446 CTGCCTACCCAAAATCATAATGG + Intergenic
1056654223 9:88495976-88495998 CTGTAATCCCAACTTTGTAATGG + Intergenic
1185744880 X:2564631-2564653 CTGTCACCCCAAGATTATAAAGG + Intergenic
1185748928 X:2594797-2594819 CTGCATCCCCAGAATTTTAAGGG + Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1193546838 X:82841869-82841891 CTGTAACCTCAAAATTATATAGG + Intergenic
1194900704 X:99507425-99507447 CTGCATTCCCACAAGTAAAATGG + Intergenic
1196300665 X:114047102-114047124 CTGTAATCCCAGAATTTTAGGGG + Intergenic
1198824540 X:140685477-140685499 CTGCACTTGCAAAATTATGAGGG + Intergenic
1199141489 X:144318989-144319011 CTGCAAGTCCAAAAATATGAAGG + Intergenic
1199362035 X:146932052-146932074 CTGGAATTCCAAAATTCCAAAGG + Intergenic