ID: 1005287123

View in Genome Browser
Species Human (GRCh38)
Location 6:24339688-24339710
Sequence ACAGAATTATAAAATCATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 978
Summary {0: 1, 1: 1, 2: 7, 3: 83, 4: 886}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005287123_1005287125 9 Left 1005287123 6:24339688-24339710 CCATTATGATTTTATAATTCTGT 0: 1
1: 1
2: 7
3: 83
4: 886
Right 1005287125 6:24339720-24339742 CAGAGTAATTACATGGTGCCTGG No data
1005287123_1005287124 2 Left 1005287123 6:24339688-24339710 CCATTATGATTTTATAATTCTGT 0: 1
1: 1
2: 7
3: 83
4: 886
Right 1005287124 6:24339713-24339735 GTGTACTCAGAGTAATTACATGG 0: 1
1: 0
2: 1
3: 17
4: 141
1005287123_1005287126 10 Left 1005287123 6:24339688-24339710 CCATTATGATTTTATAATTCTGT 0: 1
1: 1
2: 7
3: 83
4: 886
Right 1005287126 6:24339721-24339743 AGAGTAATTACATGGTGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005287123 Original CRISPR ACAGAATTATAAAATCATAA TGG (reversed) Intronic
900846091 1:5102221-5102243 ACACAAATACAAAATCATACTGG + Intergenic
901040700 1:6361443-6361465 GCAGAATTGTACAATCAAAAAGG + Intronic
901262134 1:7880318-7880340 AGAGACTTAAAAAATCACAAAGG + Intergenic
901588920 1:10322710-10322732 AAATAATTATAAAATGAGAAAGG - Intronic
901905917 1:12410657-12410679 AAAAAATTATCAAATAATAAGGG + Intronic
902976722 1:20093880-20093902 ACAGAAAAATAAAATTATCAAGG - Intergenic
903204636 1:21772106-21772128 ATTAAATTATAAAAACATAAAGG + Intronic
903902554 1:26658747-26658769 ACTGAATTGTACAATCAAAAAGG + Intergenic
903930720 1:26860845-26860867 AGAGAATAAGAAAATCAAAAGGG + Intergenic
905532341 1:38691235-38691257 ACAGAATTACACAGGCATAAGGG + Intergenic
906879136 1:49571098-49571120 ACAGAATTAGAAAAAAAAAAAGG - Intronic
906904251 1:49871612-49871634 TCAGTATAATAAAATCATATAGG + Intronic
907808990 1:57849845-57849867 ACATAATTATAAAAATAAAATGG + Intronic
907813878 1:57899485-57899507 ACAGAATTTTAACAGAATAAAGG + Intronic
908130819 1:61073722-61073744 ACAGTATTATATAATCTTATAGG - Intronic
908136897 1:61142600-61142622 ACAGGATTATGAAATTGTAAAGG + Intronic
908833465 1:68204878-68204900 ACAAAATTATAAGCTCCTAAGGG + Intronic
908946777 1:69508046-69508068 TAAGGATTATAAAATCACAAAGG + Intergenic
908971222 1:69834157-69834179 AGATAATTAGACAATCATAAAGG - Intronic
910007969 1:82423248-82423270 ACAGAGTTGTAAAGTCACAAGGG - Intergenic
910261875 1:85300751-85300773 ACAGAACTAGAAAAATATAACGG + Intergenic
910521006 1:88122466-88122488 AAAGATTCATAAAATCATCAAGG + Intergenic
910609374 1:89125024-89125046 ACAAAATTATCAAATTATCAAGG - Intronic
910953456 1:92676016-92676038 ACAGAATTAAAAAAAAAAAAAGG + Intronic
911261279 1:95689337-95689359 ACAGAATTCTAAAAATTTAATGG + Intergenic
911280013 1:95912671-95912693 AGAAAATTATATAATAATAAAGG - Intergenic
911459183 1:98167829-98167851 ACATACTTAGAAAATCATAATGG - Intergenic
911556390 1:99350371-99350393 ACAGAATGTTAAACTAATAATGG + Intergenic
911888517 1:103336099-103336121 ATATAATTATAAAATTAAAATGG + Intergenic
911942571 1:104066548-104066570 ACACAAAAATAAAATAATAATGG - Intergenic
911998016 1:104792311-104792333 ATAGTATTCTAAAATTATAATGG - Intergenic
912519786 1:110237469-110237491 ACAAAATTACCAAATCAAAATGG + Intronic
912622194 1:111173065-111173087 ATAGAATTACAAAATAAAAATGG - Intronic
913146805 1:115999842-115999864 AGATAATTATATAATAATAAAGG - Intronic
914233103 1:145782809-145782831 AAAGAATACTGAAATCATAAAGG + Intronic
915182705 1:154076957-154076979 ACAGAATCATAAAAACAGAAAGG + Intronic
915487002 1:156228526-156228548 ACTGAATTATCATACCATAAAGG + Intronic
915761433 1:158317512-158317534 ACACAATAAAAAAATGATAAAGG - Intergenic
915777654 1:158508076-158508098 AAAAAATTAACAAATCATAAAGG - Intergenic
915887063 1:159733728-159733750 ACACAATAAAAAAATGATAAAGG + Intergenic
916872202 1:168927879-168927901 ACACAATAAAAAAATGATAAAGG + Intergenic
916916394 1:169411179-169411201 ACACAATAAAAAAATGATAAAGG + Intronic
917128698 1:171716944-171716966 ACAGAATTTTAGAATAGTAAGGG - Intronic
918055460 1:181017632-181017654 ACAGAACTAAACAATCAAAATGG + Intronic
918567063 1:185947007-185947029 ACTGAATTTTATAACCATAATGG + Intronic
918596174 1:186295719-186295741 GCAGATTTTTAAAATAATAAAGG + Intergenic
918696817 1:187555155-187555177 ACGGGATGAGAAAATCATAAGGG + Intergenic
918922795 1:190735307-190735329 GCTGAATTATAAAATGATTAGGG - Intergenic
919120399 1:193333254-193333276 AAAGAATTAAAAAAGCATATGGG - Intergenic
919604759 1:199668486-199668508 ACAGTATTATAAACTCTTCAAGG - Intergenic
920630657 1:207648285-207648307 ATAGAATTATAAAATGAATAGGG + Intronic
921004444 1:211079108-211079130 ACACAATAAAAAAATGATAAAGG + Intronic
921485952 1:215715673-215715695 TCAGAATTACATAAACATAATGG - Intronic
922622151 1:226997306-226997328 ACATAATAAAAAAATGATAAAGG - Intronic
923007417 1:230062402-230062424 ACAGAATTATACACTTAAAATGG - Intronic
923974211 1:239241577-239241599 TCACAATTATTAAATCATAAAGG - Intergenic
924134818 1:240953935-240953957 ATAGAATTAAAAGATAATAAAGG + Intronic
924273875 1:242365052-242365074 AAAAAATAATAAAATAATAAGGG + Intronic
924483242 1:244455205-244455227 ACAGAAATAAAAAACCAGAAGGG - Intronic
1063675279 10:8135878-8135900 GAAAAATTATAAAATCATATGGG - Intergenic
1063736401 10:8760137-8760159 ACATAATTATAGAATCAAGAAGG + Intergenic
1064207145 10:13334056-13334078 AAAGAACCATAAAATCCTAAAGG + Intronic
1064777686 10:18797192-18797214 AGGGAATTATATAATGATAAAGG + Intergenic
1065068285 10:21996155-21996177 ACAGAGTTATACAAAAATAAAGG - Intronic
1065130063 10:22611761-22611783 ACAGAAAAAGAAAATCATAATGG + Intronic
1065777473 10:29134289-29134311 ATAGAATAAGGAAATCATAAGGG - Intergenic
1065987909 10:30974769-30974791 ACAGAATTTTAAAGTTAGAAAGG + Intronic
1066017927 10:31266984-31267006 ATAGAATCATAAAATAATCAAGG + Intergenic
1066682734 10:37949774-37949796 AGAAAATTATAAAATGATACAGG + Exonic
1068035551 10:51755776-51755798 ACAGAATCTTAAAATCAAAATGG + Intronic
1068055484 10:52007530-52007552 ACAGCATTATATAATGGTAAAGG + Intronic
1068143933 10:53041328-53041350 ACAGAATATTAAAATAATAGAGG - Intergenic
1068337111 10:55648327-55648349 AAATAATTTTAAAATTATAAAGG + Intergenic
1068349744 10:55827448-55827470 ACAGGATTATAAAATCCACAGGG + Intergenic
1068602708 10:58972466-58972488 ATAGAATTATAAGATCTTAAAGG + Intergenic
1068670531 10:59717846-59717868 ATAAAATTATAAAATGATATAGG + Intronic
1068875623 10:61992848-61992870 CGAGAATTACAAAATCATTAAGG + Intronic
1069309228 10:67012473-67012495 TCATCATTCTAAAATCATAAAGG - Intronic
1070510175 10:77153692-77153714 GCAGAATAAAAAAATCATCAGGG - Intronic
1071161254 10:82747629-82747651 AAATAATTAAAAATTCATAAAGG - Intronic
1071763515 10:88635373-88635395 ACACAATTAAAAAAAGATAAAGG - Intergenic
1071885290 10:89943207-89943229 ACAGAGGTAAAAAATCATAAGGG - Intergenic
1071978197 10:90976458-90976480 ACAAAATTATAAACTCTTTAGGG + Intergenic
1072282928 10:93885865-93885887 ATAGAAAAATAAAATCAAAATGG + Intergenic
1072437448 10:95427161-95427183 ACAGAATTAACAAAATATAAGGG + Intronic
1072859995 10:98993825-98993847 TCAAAATTATGAAATCAGAAAGG - Intronic
1073584829 10:104699751-104699773 AAAGTATTATAAAACCACAAAGG + Intronic
1074636048 10:115318741-115318763 ACACAATAAAAAAATGATAAAGG - Intronic
1074673998 10:115827615-115827637 AAAGAATTCTAACATCCTAATGG + Intronic
1075173290 10:120135827-120135849 ACAGAACCATAAAATTCTAAGGG - Intergenic
1075319297 10:121477176-121477198 AAATAATTCTAAAATCAAAATGG + Intergenic
1075432378 10:122398688-122398710 ACAGTATTATTAAATAATATGGG + Intronic
1077641423 11:3885114-3885136 ACTGAATTATAAAATCTAAGAGG + Intronic
1077703702 11:4464216-4464238 AAAGAATTATAAAATGGAAAAGG + Intergenic
1077785241 11:5376601-5376623 ACACAATAAAAAAATGATAAAGG + Intronic
1077940435 11:6835015-6835037 AAAGAATTTTAAAAGCATACAGG + Intergenic
1078201296 11:9186295-9186317 ACATAATTTTAAAATCTTAAAGG - Intronic
1078389466 11:10924364-10924386 ACATAAAAATAATATCATAATGG + Intergenic
1078786244 11:14497024-14497046 ACACAAAAATAAAATCAAAATGG + Intronic
1078918814 11:15807585-15807607 ACAGAATTTTATAATCATGATGG - Intergenic
1079768354 11:24424489-24424511 AGGGAATTAAAAAATCATACAGG + Intergenic
1079875439 11:25850728-25850750 AAAAAATTATTAAATCACAAAGG + Intergenic
1079935561 11:26611843-26611865 AAAAAATTATATAATGATAAAGG - Intronic
1080088998 11:28321527-28321549 ACAGACATATAAAATATTAATGG + Intronic
1080289610 11:30656126-30656148 ATAGATCTATAAATTCATAAAGG + Intergenic
1080471271 11:32547786-32547808 GCAGAAATATAAACTCATAAAGG + Intergenic
1080782822 11:35447069-35447091 AGGGCATTATATAATCATAAAGG - Intronic
1080788427 11:35497527-35497549 ACAGAATTATACACTTAAAATGG + Intronic
1080955821 11:37094507-37094529 AGAGAATTATAAATTCAGATTGG - Intergenic
1081070053 11:38600586-38600608 AAAGCATTATATTATCATAATGG - Intergenic
1081105011 11:39056056-39056078 ACTGAATGATAAAATTATTAAGG - Intergenic
1081271628 11:41091710-41091732 ACAAAATCTTAAAATCATAATGG - Intronic
1081819048 11:45973330-45973352 ACTGAAATAGAAATTCATAAGGG - Intronic
1082059366 11:47847534-47847556 AAAGCACTATAAAAACATAACGG + Intronic
1082180746 11:49116195-49116217 AGAGCATTACAAAATGATAAAGG + Intergenic
1082911246 11:58377031-58377053 AGAGAATTCTAAAAACAGAAAGG + Intergenic
1084076023 11:66777012-66777034 ACAGTATTAAAAAAACATGATGG - Intronic
1085223701 11:74898674-74898696 AGATAATTATATAATGATAAAGG + Intronic
1085555991 11:77422213-77422235 ACATTTTTATAAAATCATACAGG + Intronic
1086121763 11:83312064-83312086 AGAGAATTATAATCTAATAAAGG - Intergenic
1086651491 11:89296346-89296368 TCAGAGTTACAAAATCAAAATGG + Intergenic
1086828539 11:91530299-91530321 ACAAATGAATAAAATCATAAAGG + Intergenic
1087332226 11:96794476-96794498 ACATGATTTTAAAATCCTAATGG - Intergenic
1087539800 11:99502096-99502118 GCAGAATTATAAAATAATGGAGG - Intronic
1087689360 11:101301910-101301932 CCAGAAATATAAAAATATAAAGG - Intergenic
1087788022 11:102376730-102376752 AGACATTTATAAAATAATAATGG + Intronic
1087905880 11:103696775-103696797 ACAGAATTATATACTTTTAAAGG - Intergenic
1088044094 11:105426314-105426336 ACACAAAAATAAAATCAAAATGG + Intergenic
1088240273 11:107767072-107767094 AGAGCATTATATAATAATAAAGG + Intergenic
1088246226 11:107820630-107820652 ACTCTGTTATAAAATCATAATGG - Intronic
1088543145 11:110934343-110934365 ACAGAATGCTAACATCAGAAGGG - Intergenic
1088681422 11:112246185-112246207 ACAAAAATATCAAATCAAAATGG + Intronic
1089043911 11:115481985-115482007 ACACAATTGTCAAATCATACAGG - Intronic
1089077540 11:115750382-115750404 ATAGAATCATGAAAACATAAAGG + Intergenic
1090078325 11:123593529-123593551 AGAGAATTAAAAAAACACAACGG - Intronic
1090262808 11:125333798-125333820 AGAGAATTAGAAAATAAAAAGGG - Intronic
1090611961 11:128479281-128479303 AGAGAATTATAAGAGAATAAAGG + Intronic
1090658940 11:128867311-128867333 ACAGACTCATAAAATCAACAGGG - Intronic
1090816785 11:130304384-130304406 AGAGTATTAAAAAATCATATTGG + Intronic
1091000436 11:131906483-131906505 ACAGAATGATACATTCAGAAGGG - Intronic
1091984986 12:4903370-4903392 ACAGAATTTTAAATTGAGAAGGG - Intergenic
1093043746 12:14417076-14417098 ATAGGATTATAAAATAAAAATGG - Intronic
1093102458 12:15044481-15044503 ATACAATTATAAAATCAAAGAGG + Intergenic
1093153485 12:15651813-15651835 ACTGATTTAAAAACTCATAAAGG - Intronic
1093476673 12:19563176-19563198 AAAAAATTATCAAATCACAAAGG - Intronic
1093581189 12:20785654-20785676 ATATAAATATAAAATCAAAATGG - Intergenic
1093664636 12:21796711-21796733 ATAGAATCATAAAATACTAAAGG - Intergenic
1093717784 12:22403381-22403403 ACACAATAAAAAAATGATAAAGG + Intronic
1095190630 12:39254191-39254213 ATAAAATTATTAAATCACAAAGG - Intergenic
1095236608 12:39803947-39803969 ACAGAATTAAAAAAACAACAGGG + Intronic
1095278218 12:40316465-40316487 ACTCAATTATTAAATGATAATGG + Intronic
1095415823 12:41976017-41976039 ACACAATAAAAAAATGATAAAGG - Intergenic
1095451742 12:42338227-42338249 ACAGAATTTAAAACTCCTAATGG - Intronic
1095850185 12:46794473-46794495 ACAGAATAAAAACATTATAAAGG + Intronic
1095900138 12:47319504-47319526 ATAGAATAATGAAATGATAAAGG + Intergenic
1096253430 12:50048384-50048406 AGAGAAATTTAAATTCATAATGG + Intergenic
1096531887 12:52247770-52247792 ACCGTATCATAAAATCCTAAAGG - Intronic
1096938073 12:55306378-55306400 ACCCACTTAAAAAATCATAAAGG + Intergenic
1097594238 12:61608540-61608562 AGAAAATTATAAAAACACAAAGG - Intergenic
1098207184 12:68123914-68123936 AAAGAATTATCTAATCAGAAAGG - Intergenic
1098215475 12:68212033-68212055 ATAGAAAAATAAAATCAAAATGG - Intronic
1098365142 12:69694490-69694512 GCAGAAGTATAATATCATAAAGG - Intronic
1098642970 12:72860767-72860789 ACAAAATGATAAAATCTTCAGGG + Intergenic
1098685071 12:73409575-73409597 AAATAATTCTAAAATCATAAAGG + Intergenic
1099016996 12:77355459-77355481 ACAGATTAAAAAAATGATAAAGG - Intergenic
1099203158 12:79699028-79699050 ACAGAACTGTAAGATGATAAAGG - Intergenic
1099485964 12:83229678-83229700 ACACAATAAAAAAATGATAAAGG - Intergenic
1099569309 12:84295515-84295537 CCAGAAATATCAAATCAAAAAGG + Intergenic
1099578421 12:84408829-84408851 ACAGAGTTATAAAACCATATTGG + Intergenic
1099661236 12:85566171-85566193 AAAGGATTATAAATACATAAAGG + Intergenic
1099900658 12:88707540-88707562 AGGGAATTATATAATGATAAAGG - Intergenic
1100569238 12:95831361-95831383 CCAGAATTATAAAGTCTTATAGG + Intergenic
1100907508 12:99318519-99318541 ACACAATAAAAAAATGATAAAGG - Intronic
1101068200 12:101045538-101045560 ACAGAAATATTAAATCAGATTGG + Intronic
1101077274 12:101144064-101144086 ACAGCATTATGAAATTATTAAGG - Intergenic
1101258585 12:103005646-103005668 ACAAAATTATAATGTCAGAAGGG + Intergenic
1101486315 12:105165138-105165160 AAAGAACTGTAAAATCATAGGGG + Intronic
1102197980 12:111037748-111037770 GCAGAAAAAGAAAATCATAAAGG - Intronic
1102301336 12:111773747-111773769 ATAGAATTTTAAAATCAGAGAGG + Intronic
1102337414 12:112093576-112093598 ACAAAATAATAAAAACATCATGG + Intronic
1102683762 12:114708317-114708339 AAAGAAAAAAAAAATCATAATGG + Intergenic
1102722923 12:115033581-115033603 ACAGAGTTGTGAAAACATAATGG + Intergenic
1102929778 12:116853294-116853316 AGTGAATCATAAAATAATAAGGG - Intronic
1103349833 12:120276500-120276522 AAAGAATTATAAGGTCAAAAAGG + Intergenic
1104045968 12:125163170-125163192 AAATAATTTTAAAATAATAATGG - Intergenic
1104987742 12:132606380-132606402 ACAGACTTTTAAAAACTTAATGG + Intronic
1105297207 13:19098331-19098353 ACAGAAATTTAATATAATAAAGG + Intergenic
1105320218 13:19313006-19313028 AGGGAATTATATAATGATAAAGG - Intergenic
1105552325 13:21409458-21409480 ACACAATAAAAAAATGATAAAGG - Intronic
1106745921 13:32706548-32706570 ACAGAAATAAAAAATGATAAAGG - Intronic
1106817149 13:33421237-33421259 ACACAATAAAAAAATGATAAAGG + Intergenic
1106932294 13:34679754-34679776 TCAGAATCATAGAATTATAAAGG + Intergenic
1107215518 13:37913737-37913759 ACATCATTATAAAATTAAAATGG - Intergenic
1107578903 13:41760344-41760366 AGAGAATTATAAGAGAATAAAGG - Intronic
1107920900 13:45206061-45206083 ACTTTATTATAAAATAATAACGG + Intronic
1108582951 13:51842298-51842320 AAAGAAGTTTAAAATTATAATGG - Intergenic
1108759148 13:53541761-53541783 ACAGAAACAGTAAATCATAAAGG - Intergenic
1108785946 13:53901306-53901328 TCAGAAATCTAAAAACATAATGG - Intergenic
1108881599 13:55126367-55126389 ACAGAGTTTTAAAAGCATAATGG - Intergenic
1108998593 13:56766436-56766458 ACACAATAAAAAAATTATAAAGG + Intergenic
1109239198 13:59862777-59862799 ATAAAATTTTAAAATCACAAAGG + Intronic
1109250112 13:60009454-60009476 ACAGAATTAAAAAATGATGGGGG + Intronic
1109490123 13:63086735-63086757 ATAGAATTTTAAAATTATTATGG - Intergenic
1109682823 13:65774900-65774922 AGAGAATTACAAAATAATAGAGG - Intergenic
1109725228 13:66331884-66331906 ACAGAATGATTAAATGAAAATGG + Intronic
1109747904 13:66650381-66650403 AGAGCATTATATAATGATAAAGG + Intronic
1109816505 13:67591665-67591687 ACACAATAAAAAAATAATAAAGG + Intergenic
1109901995 13:68785753-68785775 ACAAAATTATATAAAGATAATGG - Intergenic
1110054989 13:70956524-70956546 ACAAATTTATAAAATAATATTGG - Intergenic
1110215027 13:73015563-73015585 AGAGAATTATAAAAAAATCAAGG - Intronic
1110310799 13:74047036-74047058 ACAGCATTATGAAATCTAAATGG + Intronic
1110381933 13:74862336-74862358 ACAGTATTGTTAAATAATAATGG - Intergenic
1110606667 13:77440682-77440704 ACACAATAAAAAAATGATAAAGG - Intergenic
1110611097 13:77488846-77488868 ACACAAAAATAAAATCAAAACGG - Intergenic
1110628774 13:77681557-77681579 AAGGCATTATAAAATTATAAAGG + Intergenic
1110816664 13:79868196-79868218 ACAGAAAAATAAAAACATACTGG + Intergenic
1110816845 13:79870777-79870799 ACAAAATAATAAAATTACAAAGG - Intergenic
1111132076 13:83990194-83990216 ACTGAATTATTACATCATATAGG - Intergenic
1111171873 13:84537449-84537471 ACAGAAATATAATATTTTAAAGG + Intergenic
1111436082 13:88210021-88210043 ACAGAAAAAGAAAATCCTAAAGG + Intergenic
1111446858 13:88357378-88357400 ACATCCTTATATAATCATAAAGG + Intergenic
1111679173 13:91423359-91423381 AAAGGATTAAAAAATCATTAAGG + Intronic
1111718808 13:91915817-91915839 CAAGAATTATAAAATCTAAAAGG + Intronic
1111798759 13:92957272-92957294 ACAGAAAAATCAAATCAAAATGG - Intergenic
1112060754 13:95737671-95737693 ACACAATAAAAAAATGATAAAGG - Intronic
1112206691 13:97330808-97330830 ATAGGATTGTAAAATCCTAATGG - Intronic
1112229715 13:97576511-97576533 GCATAATTTTAAATTCATAAGGG - Intergenic
1112619867 13:101043792-101043814 ACACAATAAAAAAATGATAAAGG - Intergenic
1112979374 13:105363043-105363065 AAAGAATTAAAAAAACAAAAAGG + Intergenic
1113718978 13:112537957-112537979 ACAGAATTCTTGAATCATCATGG + Intronic
1114334882 14:21677840-21677862 AGAGAATTAACAAATGATAAAGG - Intergenic
1114408216 14:22476003-22476025 ACAGATTTATAAGAAGATAACGG - Intergenic
1114793283 14:25683061-25683083 ACCAAATTATTAAATTATAAAGG - Intergenic
1115253489 14:31373884-31373906 ACAGAAGTAGATCATCATAAAGG - Intronic
1115818732 14:37191092-37191114 ACACAATAAAAAAATCATAAAGG + Intergenic
1116227324 14:42168891-42168913 ACACAATAAAAAAATGATAAAGG - Intergenic
1116291800 14:43052792-43052814 TCAGAATCATAAAATCATTTTGG - Intergenic
1116615258 14:47128649-47128671 ATAGAAATATAAAATCTTAGTGG - Intronic
1116696607 14:48185295-48185317 ATAGAATGAAAAAATAATAATGG + Intergenic
1116775952 14:49180966-49180988 ACACAATAAAAAAATGATAAAGG + Intergenic
1116980330 14:51163195-51163217 ATAGAAAAATAAAATCTTAAAGG - Intergenic
1117021141 14:51571854-51571876 ATAGACTTATAAATTCAAAAAGG + Intronic
1117339756 14:54783112-54783134 AAAGAATTGCAAAATCCTAAGGG - Intronic
1117439310 14:55745229-55745251 ACAGAATTATAGACACAAAAAGG - Intergenic
1118134905 14:63012758-63012780 AAAGAAGTCTAAAAACATAATGG + Intronic
1118622580 14:67627166-67627188 ACTGAATTATAAATTCTAAAAGG + Intronic
1118666216 14:68073258-68073280 AGGGAATTACATAATCATAAAGG - Intronic
1118802094 14:69200094-69200116 ACAAAATTATAAGATTACAATGG - Intronic
1119298894 14:73555273-73555295 ACATATTAATAACATCATAAAGG + Intronic
1119342990 14:73896628-73896650 CCAAAATAATAAAATAATAAAGG - Intronic
1119434500 14:74589121-74589143 ACAGAATTTTTAAATAATGATGG + Intronic
1120135932 14:80868541-80868563 AGAAAATTATCAAATCACAAAGG + Intronic
1120305024 14:82758945-82758967 GCACATTTATAAAATCATCAAGG + Intergenic
1120323383 14:82994249-82994271 ACATAATTAGAAAATTATTATGG + Intergenic
1120470294 14:84915086-84915108 GAATAATTATAAAAACATAATGG - Intergenic
1120475833 14:84985543-84985565 ACAGAATTATATAACTATCAAGG + Intergenic
1120531767 14:85640536-85640558 ACAGAATTATTTAATAATAATGG + Exonic
1120567431 14:86077343-86077365 ACGCAATTAAAAAATGATAAAGG - Intergenic
1120774519 14:88419254-88419276 ACAGATTTAGAAAATCCTGAAGG + Intronic
1121905577 14:97739438-97739460 ACACAATAAAAAAATGATAAAGG - Intergenic
1123201978 14:106674809-106674831 ACAGAATTCTAAAATTAGAGAGG + Intergenic
1202943487 14_KI270726v1_random:5493-5515 ACAGAATTCTAAAATTAGAGAGG - Intergenic
1123453205 15:20387160-20387182 ACAGATTTATCATTTCATAAAGG - Intergenic
1124018187 15:25896297-25896319 ACAGCAGGATAAAATAATAAAGG + Intergenic
1124971443 15:34494030-34494052 AGAGAGTTATAAAATAATATTGG + Intergenic
1125068541 15:35523176-35523198 ACAGAAATAAGAAATAATAATGG - Intronic
1125122798 15:36182794-36182816 ACAGAGTAAGAAAATCCTAATGG - Intergenic
1125161445 15:36649139-36649161 ACATAATCAGAAAATCCTAATGG + Intronic
1125161657 15:36651389-36651411 ACATAATTAGAAAATCCTAATGG - Intronic
1125183066 15:36899185-36899207 ACAGAATTTTAAAAACATATGGG + Intronic
1125222659 15:37357241-37357263 AAAGATTTCTAAAATCAAAAGGG - Intergenic
1126069703 15:44855191-44855213 ACAGAATTAAAAACCCAAAATGG + Intergenic
1126088827 15:45033971-45033993 ACAGAATTAAAAACCCAAAATGG - Intronic
1126515651 15:49533967-49533989 AGAAAATAATAAAATCACAAAGG - Intronic
1126927472 15:53606110-53606132 ACAGAATCATAGAACCTTAAAGG + Intronic
1126968281 15:54081523-54081545 AGAGTATTATATAATGATAAAGG - Intronic
1127024188 15:54784639-54784661 ACACAATTAAAAAATGATAAAGG + Intergenic
1127411891 15:58717109-58717131 ACAGAATTGTTAAGTGATAAAGG - Intronic
1127442984 15:59029582-59029604 ACAGAAATATATAATCTTACAGG - Intronic
1127866184 15:63035133-63035155 ACAGAACTATAAAATAAAACAGG + Intergenic
1128425655 15:67540011-67540033 ACAGAAAAATGAAATCAGAAGGG - Intergenic
1128584470 15:68835982-68836004 ACAGAAGGAAAAAAACATAATGG + Intronic
1129147420 15:73661466-73661488 AAACAACCATAAAATCATAATGG + Intergenic
1129973367 15:79800090-79800112 CTAGAATTATAAAATCTTACAGG - Intergenic
1130200495 15:81821842-81821864 ACACAATAAAAAAATGATAAAGG + Intergenic
1130216646 15:81977946-81977968 ACAGAAAAATCAAATCAAAATGG + Intergenic
1130398526 15:83527447-83527469 ACATCATTATATAATGATAAGGG - Intronic
1130917816 15:88319494-88319516 AAAGAATTTTAAAAGCATAGGGG + Intergenic
1131321558 15:91398170-91398192 AAAAAATTATCAAATCAGAAAGG - Intergenic
1131521096 15:93116213-93116235 AGAGATTTATAAAAACATAAGGG - Intergenic
1131864781 15:96696084-96696106 ATAAAATTATAAAAACATGATGG + Intergenic
1131917802 15:97289917-97289939 ACAGAATTACAAAATACTGAAGG - Intergenic
1131940640 15:97561178-97561200 ACAGAATTATAAAATATAACAGG - Intergenic
1132927827 16:2440715-2440737 ACAAAATTACAAATTGATAATGG + Intronic
1133164074 16:3934217-3934239 ACAAAATTAAAAAATCATCTGGG + Intergenic
1133391094 16:5410774-5410796 AAAGAATTTTAAAGTCAGAAAGG - Intergenic
1133903417 16:9998656-9998678 ACAGTAATACAAAAACATAAAGG - Intronic
1134284518 16:12848792-12848814 TCAGAATCATAAAATCACAAAGG - Intergenic
1134563421 16:15230506-15230528 ACAGAAATAAAAGATCAGAATGG + Intergenic
1134743621 16:16570366-16570388 ACAGAAATAAAAGATCAGAATGG - Intergenic
1134923946 16:18142132-18142154 ACAGAAATAAAAGATCAGAATGG + Intergenic
1135054947 16:19223894-19223916 TCAGTATGATAAAATCATTAAGG + Intronic
1135474903 16:22765341-22765363 ACACAATTAGAAACTCAAAAGGG + Intergenic
1135609049 16:23848906-23848928 ACAGGATTATAAACTCAGTAAGG - Intronic
1136351052 16:29708231-29708253 ATAGAATTAGAAAATCATGTTGG + Intergenic
1137314878 16:47307214-47307236 AGAAAATTTAAAAATCATAAAGG + Intronic
1137437344 16:48466602-48466624 AGAGAATTATAATATAAAAATGG - Intergenic
1137509183 16:49083102-49083124 ATAGAAAAATAAAATCATATGGG + Intergenic
1137634785 16:49976463-49976485 ATAAAATTATAATTTCATAATGG + Intergenic
1137804968 16:51296496-51296518 GCAGAATTCTAAAACCAAAATGG - Intergenic
1138355545 16:56375709-56375731 ACAGCATTACAAAATGATCATGG + Intronic
1139004483 16:62553870-62553892 ACACAATAAAAAAATGATAAAGG + Intergenic
1140351774 16:74269205-74269227 ACAGCCTTACAAAATCCTAAAGG + Intergenic
1140494444 16:75371854-75371876 AGGAAATTATAAAATCATCAAGG - Intronic
1140664840 16:77217763-77217785 ACTAAATTATAAAAGCATTAGGG - Intergenic
1140928507 16:79605779-79605801 ACAGAGCTATAAAATGATGATGG + Intergenic
1142335696 16:89489052-89489074 ACAGAAGCAGAAAATCTTAATGG + Intronic
1203105893 16_KI270728v1_random:1358206-1358228 ACAGAATTGTCAAAACCTAAGGG + Intergenic
1203127621 16_KI270728v1_random:1604162-1604184 ACAGAATTGTCAAAACCTAAGGG - Intergenic
1143235856 17:5399323-5399345 ACAGAAATAAAAGATTATAAAGG - Intronic
1144207728 17:12990832-12990854 TCAGAAATATAAAATGATATAGG - Exonic
1144301993 17:13929902-13929924 ACAGAAATATCAAACCAAAAGGG + Intergenic
1144432029 17:15200967-15200989 ACATAATGATAATATGATAAGGG + Intergenic
1146748269 17:35351768-35351790 AAAGGATTAAATAATCATAACGG + Exonic
1146751645 17:35387207-35387229 ACAGTATTAGAAGATCATCAAGG - Intergenic
1148258902 17:46162005-46162027 ATAGAAATATAAAATCAAACAGG + Intronic
1149315935 17:55438717-55438739 ACAAAATAAAGAAATCATAATGG + Intergenic
1149653697 17:58297285-58297307 GCAGAAGGATAAAATAATAAAGG + Intergenic
1149916888 17:60617896-60617918 ATAGAAATATGAAATCAGAAAGG - Intronic
1150000675 17:61436678-61436700 AAAAAATTATTAAATCACAAAGG - Intergenic
1150626460 17:66844447-66844469 ACATGATGATAAAATTATAAAGG + Intronic
1153018716 18:607427-607449 ACAAAATTATAAAATAAAATAGG - Intronic
1153105869 18:1525426-1525448 ATAGAGTTATAATAGCATAATGG + Intergenic
1153148431 18:2059702-2059724 ACACTATTATAAAATAAAAATGG + Intergenic
1153974465 18:10255511-10255533 ACACAATAAAAAAATGATAAAGG - Intergenic
1155330737 18:24713667-24713689 ACACAATAAAAAAATGATAAAGG - Intergenic
1155413852 18:25574922-25574944 ACAGAAAAATAAAATCAAAATGG - Intergenic
1155432477 18:25775049-25775071 ACACAATAAAAAAATGATAAAGG + Intergenic
1155712464 18:28899809-28899831 ACAGAATTATAAAGGGATATAGG - Intergenic
1156669049 18:39445624-39445646 ACACAATAAAAAAATGATAAAGG + Intergenic
1156943396 18:42796810-42796832 ACTGCATTATAAATTCAGAATGG + Intronic
1157022552 18:43804219-43804241 ACAGGATTCTAAAAACACAAGGG - Intergenic
1157043889 18:44072600-44072622 TCAGAAATAGAAAATAATAATGG - Intergenic
1157774688 18:50383277-50383299 ACAGAATTTCAAAAACAAAAAGG - Intronic
1158011398 18:52732343-52732365 AAAGAATTCTAAAATAATCATGG + Intronic
1158524653 18:58201879-58201901 ACAGAGTTATAAAAAGACAAGGG - Intronic
1158728763 18:60000249-60000271 ACACAATGAAAAAATGATAAAGG - Intergenic
1158748016 18:60224589-60224611 AAGTCATTATAAAATCATAAAGG - Intergenic
1158748057 18:60225304-60225326 ACAGAATTCTAAAAGCAGTAAGG - Intergenic
1158792315 18:60796808-60796830 ACAACATTAAAAAATCAAAATGG + Intergenic
1159118861 18:64146326-64146348 ACAGTTTTAAAAATTCATAATGG - Intergenic
1159935400 18:74362259-74362281 CCAGATTTAAAAAATCATAGGGG - Intergenic
1160207720 18:76849294-76849316 ACAGAATTCTAAATACATATTGG - Intronic
1162610820 19:11749707-11749729 ACACAAAAATAAAATCAAAATGG - Intergenic
1163936723 19:20452589-20452611 ACATAATAATAAAAACAGAATGG - Intergenic
1166273994 19:41738478-41738500 ACAGAAACATAAAACCAAAAGGG + Intronic
1167866431 19:52332452-52332474 ACAGAATAAGAAGATGATAATGG - Intergenic
1167880083 19:52450324-52450346 ACACAAAAATAAAATCAGAATGG - Intronic
926017218 2:9464267-9464289 ACAGAACTATACAATCAGACAGG - Intronic
926258829 2:11237577-11237599 ACAAAAACATAAAATCATATTGG + Intronic
926284319 2:11475854-11475876 AGAGAATTATCACATCATATTGG + Intergenic
926483139 2:13424667-13424689 ACACAATAAAAAAATGATAAAGG - Intergenic
926970340 2:18461058-18461080 ACACAATAAAAAAATGATAAAGG - Intergenic
926982936 2:18590949-18590971 TCAGGATTATAAACTCATTATGG + Intergenic
928105301 2:28466936-28466958 ACAAAATTATAAAAGTATCATGG + Intronic
928750961 2:34469797-34469819 ACACAATAAAAAAATGATAAAGG + Intergenic
929072212 2:38043634-38043656 AAAGAATTATAATATAGTAAAGG - Intronic
929256672 2:39818596-39818618 AGAGAATTATTAGATGATAATGG + Intergenic
929698692 2:44142602-44142624 ACAGAATTTTGAAAACATATAGG + Intergenic
930344755 2:50165968-50165990 AGAGAATTATACAAAGATAAGGG - Intronic
930359629 2:50361404-50361426 ACACAATAAAAAAATGATAAAGG + Intronic
930465149 2:51738048-51738070 ACACAATAAAAAAATGATAAAGG - Intergenic
930552188 2:52849699-52849721 ACATAATTAAAAAATGATAAAGG - Intergenic
930589290 2:53308036-53308058 ACATAAATATAAAATCTTAGTGG + Intergenic
930849712 2:55946696-55946718 AAAGAAATATAAAATAATAATGG + Intergenic
931012547 2:57933830-57933852 AGAAAATTATCAAATCACAAAGG - Intronic
931163448 2:59719308-59719330 ACAGAACCACAAAAACATAAAGG + Intergenic
932548848 2:72745370-72745392 AGAGAATATTACAATCATAATGG - Intronic
932843206 2:75104303-75104325 ATATAATTATATAATGATAAAGG + Intronic
933103656 2:78293015-78293037 ATAGAATTTTAAAATTACAAAGG - Intergenic
933173014 2:79144403-79144425 ACAGAAAAATAAACTCAAAATGG - Intergenic
933338946 2:80997353-80997375 AATGAATTATAAAAGGATAATGG - Intergenic
933518966 2:83346791-83346813 CCAGGATTATAAAATAATAAAGG - Intergenic
933862899 2:86487762-86487784 CCAAAATTGTAAAAACATAATGG - Intronic
934634959 2:95976558-95976580 ACAGAATTGTCAAAACCTAAGGG - Intronic
934798671 2:97128682-97128704 ACAGAATTGTCAAAACCTAAGGG + Intronic
934834757 2:97574818-97574840 ACAGAATTGTCAAAACCTAAGGG - Intronic
935086738 2:99853870-99853892 AGAGAATTACAAATTTATAATGG + Intronic
935134393 2:100286882-100286904 ACAGAATTATAAAGGAAAAAGGG + Intronic
935474842 2:103506414-103506436 AAAGAATAATAAGATAATAAAGG - Intergenic
935798536 2:106669364-106669386 TCAGGATTATATTATCATAATGG + Intergenic
936819885 2:116507934-116507956 AGAGCATTACAAAATGATAACGG - Intergenic
937050903 2:118888405-118888427 ACAGAATTATGAAATTGTAATGG + Intergenic
937061542 2:118983652-118983674 ATGGAATTATAAGATCAGAATGG - Intronic
937604969 2:123788687-123788709 ATTAAATTATATAATCATAAAGG + Intergenic
937782630 2:125856511-125856533 ACAAAATTAAAAAATCATCTGGG - Intergenic
937804990 2:126128918-126128940 AGAGAACAATAAAGTCATAAAGG - Intergenic
937860007 2:126700318-126700340 ACAAAAAGATAAAATCATGAAGG - Intergenic
938914784 2:135926275-135926297 ACAGTTTTTTAAAAACATAATGG - Intronic
939006704 2:136796732-136796754 ACAGGCTTATAACTTCATAATGG - Intronic
939250648 2:139677595-139677617 GTTAAATTATAAAATCATAAAGG + Intergenic
939451792 2:142383886-142383908 ACTGACTTTTAAAATCCTAATGG - Intergenic
939698687 2:145361709-145361731 ATATAATTATATACTCATAATGG + Intergenic
939797537 2:146665299-146665321 ACTGTATTAAAAGATCATAATGG + Intergenic
939980099 2:148769973-148769995 ACAGCATGATAAAATGATGAAGG + Intronic
940679459 2:156766092-156766114 GAAGAATTATATAATCAGAATGG - Intergenic
940913200 2:159226979-159227001 ACAGAATTAAAAGATTATAGGGG + Intronic
941171161 2:162139080-162139102 ACTAATTTATAAAAGCATAATGG + Intergenic
941196265 2:162455787-162455809 ACACAATAAAAAAATGATAAAGG - Intronic
941484082 2:166057343-166057365 ACAGAATTATAAAACTGAAAGGG + Intronic
941989210 2:171538761-171538783 ATAGGATTATAAAAATATAAGGG - Intronic
942303998 2:174588521-174588543 AGAGAATTGTAAAATAATTAAGG - Intronic
942553746 2:177149455-177149477 ACTGAATTATAAACTTATTAAGG - Intergenic
942777361 2:179599111-179599133 GCAGTATTATATAATCTTAAGGG - Intronic
942990288 2:182192519-182192541 ACAGAATGAGGAAATTATAAAGG - Intronic
942999807 2:182312312-182312334 ACAAAATTAAAAAAACATGATGG - Intronic
943196048 2:184751354-184751376 ACAGAAATATCAACTCAAAATGG + Intronic
943276285 2:185870684-185870706 ACAGTATTTTAAAATAATATTGG - Intergenic
943442807 2:187946932-187946954 AAAGCACTATAAAATCATAGTGG - Intergenic
943477682 2:188378961-188378983 AGAAAATTAGAAAATTATAAAGG - Intronic
943600240 2:189909091-189909113 AGATAATTATATAATGATAAAGG - Intronic
943694508 2:190910051-190910073 ATAGAATAATAAAATTATAAGGG - Intronic
944005926 2:194905311-194905333 ACAGAATCATAAAAATGTAATGG - Intergenic
944035780 2:195293075-195293097 ACAGAATACAAAAATGATAAAGG + Intergenic
944164798 2:196707357-196707379 ACACAATAAAAAAATGATAAAGG - Intronic
944393309 2:199242438-199242460 ACACAATAAAAAAATGATAAAGG - Intergenic
944632070 2:201637289-201637311 AAAGAATAATAAAGTCATCATGG + Intronic
944765013 2:202855427-202855449 ACACAATAAAAAAATAATAAAGG + Intronic
944805195 2:203274111-203274133 ACAGAACAAAAAAATAATAAGGG - Intronic
945282904 2:208053400-208053422 ACACAATTCTAAAGTCTTAAAGG - Intergenic
945429588 2:209749030-209749052 ACACAATAAAAAAATGATAAAGG - Intergenic
945514212 2:210742680-210742702 ACAAAAAAATAAACTCATAATGG - Intergenic
945762951 2:213936865-213936887 ACAGAATTATTAAAATAAAAAGG - Intronic
945831151 2:214787013-214787035 TCAGGATTACAAAGTCATAAAGG + Intronic
945838411 2:214859577-214859599 ACAGAATTATAAAACACTTAAGG - Intergenic
945905562 2:215588804-215588826 ACAGAATGACAGAGTCATAAGGG + Intergenic
946384680 2:219375453-219375475 ACAGAATTACAAAATCAAATAGG + Intronic
946795495 2:223346991-223347013 ACAAATTTAAAAAATCAAAAGGG + Intergenic
947284600 2:228498807-228498829 ACACACTTATAAAACCATATGGG + Intergenic
947354401 2:229277083-229277105 ACTCCATCATAAAATCATAAGGG + Intergenic
1169618970 20:7483126-7483148 AAAGAAATATAAAATCCTTAGGG + Intergenic
1169655287 20:7915907-7915929 ACAAAATTTTAAAATTAAAAAGG - Intronic
1170125905 20:12963880-12963902 CCAGAATTAGAGAATCAGAAGGG - Intergenic
1170336356 20:15274775-15274797 ACAGAAATAAAAAATTTTAATGG + Intronic
1170369211 20:15630486-15630508 ACTGGATTATAAAATCCTCAAGG + Intronic
1170444048 20:16406553-16406575 AGTGTATTATAAAATAATAAGGG + Intronic
1170869471 20:20191884-20191906 GCAGCATTTTAAAATCAAAAGGG - Intronic
1171112605 20:22497922-22497944 ACAGATTTATAAAAGCAAAAAGG + Intergenic
1173720009 20:45249117-45249139 ATAGCATTATATAATTATAAAGG + Intergenic
1173865647 20:46311075-46311097 ACAAATTTATAAATTCATAATGG + Intergenic
1174293626 20:49527712-49527734 ACTGAATTATACAATTAAAATGG + Intronic
1174953036 20:55064267-55064289 ACAAAATAAAAAAATGATAAAGG - Intergenic
1176950524 21:15040479-15040501 CCAGAATAATAAAAACACAAAGG + Intronic
1177067016 21:16451518-16451540 AAAGAATTATAACAAAATAATGG - Intergenic
1177272533 21:18868319-18868341 AGGGAATTACATAATCATAAAGG - Intergenic
1177330472 21:19654031-19654053 ACATAATTATAAAATCTTAGTGG + Intergenic
1177360866 21:20068128-20068150 ATGGCATTATGAAATCATAAAGG + Intergenic
1177426176 21:20925360-20925382 ATACAATTAAAAAATGATAAAGG + Intergenic
1177850374 21:26339860-26339882 ACAGAAAAATTAAATCAAAATGG + Intergenic
1177923026 21:27177061-27177083 ACATAATTATAAAATTATCTAGG - Intergenic
1177956296 21:27603263-27603285 ACAAAAATATAAAATGGTAAAGG - Intergenic
1177957600 21:27619136-27619158 ACATAATTGGAAAAACATAAAGG - Intergenic
1177984444 21:27956145-27956167 CCAGCATTATCAAATAATAAAGG + Intergenic
1178029910 21:28512647-28512669 ACAGTTTTATAAAATCTCAAAGG - Intergenic
1178246585 21:30958821-30958843 GCAGAAATATAAAATTTTAAAGG - Intergenic
1178892849 21:36534445-36534467 ACAGGATGATAAAAACATATGGG + Intronic
1179366388 21:40762253-40762275 ACACAATAAAAAAATGATAAAGG + Intronic
1179606750 21:42521331-42521353 ACAGAATTACAAAATAAAAAAGG + Intronic
1179608251 21:42532284-42532306 CCAGAAATATTAAATCACAAAGG + Intronic
1180100718 21:45583534-45583556 ACACATTTATAAAATATTAAAGG + Intergenic
1180306839 22:11134141-11134163 ACACAATAAAAAAATGATAAAGG - Intergenic
1180545359 22:16496324-16496346 ACACAATAAAAAAATGATAAAGG - Intergenic
1182195307 22:28509817-28509839 ACACAATAAAAAAATGATAAGGG + Intronic
1182398352 22:30053988-30054010 ACAGAATTATATACTTATAAAGG + Intergenic
1182533984 22:30986267-30986289 TCAGTAGTATAAAATCAGAACGG - Intergenic
1183563173 22:38593201-38593223 ACAGAATAAATAAAGCATAATGG + Intronic
949202879 3:1401208-1401230 ACAGACTTATGAATTAATAATGG - Intronic
949557667 3:5171297-5171319 ACACAATAATAAAATGATTATGG + Intronic
950339074 3:12225666-12225688 ACACAAATATCAAATCAAAATGG + Intergenic
950382139 3:12625381-12625403 ACAGATTTGTAAAATTAAAAAGG + Intronic
950603700 3:14058656-14058678 ACAGAATCATAAAATCTGAGTGG - Intronic
950695049 3:14692887-14692909 ACACAAAAATAAAATCAAAATGG - Intronic
951037947 3:17954150-17954172 AGAAAATTATAAAATTTTAAAGG - Intronic
951054416 3:18131272-18131294 CAAAATTTATAAAATCATAAAGG - Intronic
951150285 3:19280743-19280765 ACAGAATGCTAAAATAAAAAAGG - Intronic
951158545 3:19385978-19386000 AAATAATTTTAAAATCATATTGG - Intronic
951372097 3:21862035-21862057 ATATACTTATAAAACCATAAAGG - Intronic
951376038 3:21918705-21918727 ATAGAATTATAAAGTGATATTGG - Intronic
951653443 3:24978604-24978626 ACGCAATAAAAAAATCATAAAGG - Intergenic
951873680 3:27395716-27395738 ACAGAATTATAAACAAATAAAGG + Intronic
951922820 3:27874748-27874770 ACAGAAGTAGAAAATATTAATGG + Intergenic
952202017 3:31139436-31139458 AGAGGATTACAAAATTATAATGG + Intergenic
953372554 3:42401693-42401715 ACAGAATTGCAAAAAAATAAAGG + Intronic
954502073 3:51027506-51027528 ACAGAATTAGATAATCATCAAGG - Intronic
954519626 3:51213093-51213115 GCAGAATTGTAAAATAAGAATGG - Intronic
955426062 3:58791162-58791184 ACAGAATCAGAGAATCTTAAAGG - Intronic
955831831 3:63012904-63012926 ACACAATAAAAAAATTATAAAGG - Intergenic
957033333 3:75268457-75268479 ACGGAATTATAAATTAATAATGG + Intergenic
957423161 3:79999437-79999459 ACAGAATTAGAAAAGCAGAGAGG - Intergenic
957686253 3:83506302-83506324 ATAAAATCATAAAATCAAAATGG + Intergenic
957757918 3:84514699-84514721 ACAGCATTACATAATGATAAAGG - Intergenic
957789133 3:84917800-84917822 AAAGAATAATAAAAACATATGGG + Intergenic
958030345 3:88101155-88101177 ACTGAATTATAAACTGACAATGG - Intronic
958052354 3:88364464-88364486 ACAGGAGTATAAAAATATAAGGG + Intergenic
958218426 3:90625468-90625490 ACACAATTAAAAAATTGTAAAGG + Intergenic
958724342 3:97886254-97886276 GCAGTATAATAAAACCATAAGGG - Intronic
959114017 3:102154656-102154678 ACACAAATATAAAATCAAAATGG + Intronic
959465687 3:106683655-106683677 ATAGAATTATAAGATAAAAATGG - Intergenic
960151862 3:114257545-114257567 ATACAATAATAAAATCAAAATGG - Intergenic
960228710 3:115198470-115198492 ACACAATAAAAAAATGATAAAGG - Intergenic
960385109 3:117013135-117013157 AGAGAATTACAACATCAGAAGGG - Intronic
960790835 3:121428972-121428994 ACAAAGTTCTAAAATCATAAAGG - Intergenic
960852299 3:122068817-122068839 ACAGAATTATTAAATTGGAAAGG + Intronic
960883657 3:122372252-122372274 ACAGAAAAATAATATCAAAAGGG + Intronic
961948904 3:130725029-130725051 ACATAATTTTTTAATCATAAAGG - Intronic
962138083 3:132758692-132758714 AAATAATTATAGAATCATCAGGG - Intergenic
962590191 3:136881727-136881749 ACAAATTTATACAAACATAAAGG - Intronic
962656839 3:137555093-137555115 ACGGCATTATATAATGATAAAGG + Intergenic
962670694 3:137705191-137705213 ACAGTATTGTAAAATTATAATGG - Intergenic
962830867 3:139138570-139138592 ATATAATTATAAAATAAAAAAGG - Intronic
963227261 3:142874936-142874958 ACAGAATTATGAAGTCAGAAGGG - Intronic
963571718 3:147006119-147006141 AGGGCATTATAAAATGATAAGGG - Intergenic
964561907 3:158006070-158006092 ACAGAAAGAAAAAATCTTAATGG - Intergenic
964729749 3:159852182-159852204 ACAGAGTTCTAAAAGCAAAAAGG - Intronic
964940307 3:162152471-162152493 AAAGCATTATATAATGATAAAGG - Intergenic
965094898 3:164213311-164213333 ACAAATTAATAAAATCAGAAAGG + Intergenic
965394521 3:168145963-168145985 AAAAAATTATATAATGATAAAGG - Intergenic
965762010 3:172088806-172088828 AAGTAATCATAAAATCATAATGG - Intronic
966042683 3:175510710-175510732 ACAAAACTATGAAATCATCAAGG + Intronic
966097641 3:176224991-176225013 AGAATATTATAAAATTATAAAGG + Intergenic
966487531 3:180487976-180487998 ACACAATAAAAAAATGATAAAGG + Intergenic
966506164 3:180704020-180704042 ACAGAATCATAAAATCTCCATGG + Intronic
966522096 3:180884918-180884940 ATATAATTATAAAATGATATGGG + Intronic
966590353 3:181675272-181675294 ACAGAATTAAAAAATAGTTATGG + Intergenic
966972215 3:185054756-185054778 ACAAAGTTATATAATAATAAAGG + Intergenic
967539108 3:190643973-190643995 ACAGAATCATAACATCAGGAAGG - Intronic
967758746 3:193200039-193200061 ACACAATAAAAAAATGATAAAGG - Intergenic
967768413 3:193308063-193308085 ACAGAGTTATGAAATCAATAAGG + Intronic
967789917 3:193537417-193537439 ACACAAATATTAACTCATAATGG + Intronic
968819663 4:2840881-2840903 ACAAAAATATAAAATCCTATTGG - Exonic
969157096 4:5220554-5220576 ACAAAATTATAAAATGCAAAAGG + Intronic
969451369 4:7275653-7275675 ACAGAAGCATAAAATCACCAGGG - Intronic
970144134 4:13015025-13015047 AGAAAATTATCAAATCATAAAGG + Intergenic
970236274 4:13961378-13961400 ACACAAACATAAAATCATGAAGG - Intergenic
970749479 4:19340148-19340170 ACACAATAAAAAAATAATAAAGG - Intergenic
971211333 4:24620153-24620175 AGAAAATTATCAAATCACAAAGG - Intergenic
971298181 4:25419089-25419111 ACATAATTTTAAAATCATTCTGG - Intergenic
971373851 4:26040395-26040417 ACAGACTAATACAATCATGAAGG - Intergenic
971447690 4:26768498-26768520 ACAAAATTAATAAATCAAAAGGG + Intergenic
972029348 4:34433301-34433323 ACTGAATTTTAAAATGATACCGG - Intergenic
972656966 4:41073278-41073300 ACAAAATGGGAAAATCATAATGG - Intronic
973144637 4:46810371-46810393 AGAAAATTATCAAATTATAAAGG - Intronic
973231973 4:47850247-47850269 ACAGAACCATAAAATCTCAAAGG + Intronic
973260149 4:48155105-48155127 ACTAAAACATAAAATCATAAAGG + Intronic
974400686 4:61402384-61402406 ACAGCATTATAATTTCAAAATGG - Intronic
974481867 4:62454735-62454757 ACATCATTTTAACATCATAATGG + Intergenic
974639767 4:64612986-64613008 ATAGAATTAAAAAATGATACAGG + Intergenic
974689895 4:65284312-65284334 ACAGAATTGCAAACTCAGAATGG - Intergenic
974753703 4:66175247-66175269 ACAGAATAACCAAATAATAAAGG - Intergenic
974990932 4:69089179-69089201 AGCTAATTCTAAAATCATAATGG - Intronic
975171446 4:71236268-71236290 AAAGAATTTTAAAACCCTAAAGG + Intronic
975760525 4:77615192-77615214 ACAGAATATTAAAGTCATCAAGG + Intergenic
976363342 4:84205921-84205943 ACACAATAAAAAAATGATAAAGG + Intergenic
976438585 4:85046838-85046860 ACACAATAAAAAAATGATAAAGG + Intergenic
976527109 4:86106108-86106130 ACTGAATTAAAAAATCATCAGGG + Intronic
976585241 4:86789975-86789997 ACACAATTATTAAATGAAAATGG - Intronic
976588089 4:86821192-86821214 ACAGTATTAGAAAAACATATGGG + Intergenic
976652307 4:87449113-87449135 ATAGTAATATAAAATCATAACGG - Intronic
976672306 4:87666876-87666898 AAATAATTTTAAATTCATAATGG + Intergenic
977273956 4:94952107-94952129 ACACAATTAAAAAATGATAAAGG - Intronic
977394325 4:96452524-96452546 AAAGAATTATATAATGGTAAAGG - Intergenic
977982416 4:103340248-103340270 ACAGCAGTAGAAAATAATAAAGG + Intergenic
978627694 4:110705740-110705762 ACAGAACTAGTAAATTATAAAGG - Intergenic
978756737 4:112310927-112310949 ACAGAATCATAGAATCGAAAGGG + Intronic
978965896 4:114741235-114741257 AAAAAATTAAAAAATTATAATGG + Intergenic
979062542 4:116081320-116081342 AGATCATTATATAATCATAAAGG - Intergenic
979416439 4:120445991-120446013 AGATTATTATATAATCATAAAGG - Intergenic
979433481 4:120660664-120660686 ACACCGTTATAAAATGATAAGGG - Intergenic
979578179 4:122320510-122320532 AGAGCATTATGAAATGATAAAGG - Intronic
979802963 4:124934582-124934604 ACACAATAATCAAATCTTAAAGG - Intergenic
979930202 4:126620128-126620150 AAAGAATTACATAATGATAAAGG + Intergenic
979999978 4:127475955-127475977 ACACAATAAAAAAATCATAGAGG + Intergenic
980245823 4:130240587-130240609 AAAAAATTATAAAAAGATAAAGG + Intergenic
980248077 4:130273555-130273577 ACAGGAATATAAAATAAAAAGGG + Intergenic
980268189 4:130547343-130547365 ATAGAATTTTAAAATCATGCTGG + Intergenic
980294626 4:130895391-130895413 ACAGCATTATAATATTATAATGG + Intergenic
980381471 4:132025268-132025290 TAATTATTATAAAATCATAAAGG - Intergenic
980538962 4:134167694-134167716 AAATAATTATATAATAATAAAGG + Intergenic
980609960 4:135147154-135147176 ATGAAAATATAAAATCATAAAGG + Intergenic
980637295 4:135524259-135524281 ACAAAATAATAAAATGAAAAAGG + Intergenic
980798873 4:137722299-137722321 GCAGAGTTATGAAATCTTAATGG + Intergenic
980840032 4:138247706-138247728 AGAGAATTTTTAAATAATAAAGG + Intergenic
981353134 4:143755332-143755354 ACACAATAAAAAAATGATAAAGG + Intergenic
981737754 4:147970721-147970743 ACAGATTTATAAAAACAGCAAGG - Intronic
981989294 4:150897181-150897203 AAAGCATTATAAAATCATATAGG + Intronic
982073053 4:151712523-151712545 ACAGAAATATAACATCAAGATGG + Intronic
982277405 4:153650809-153650831 ACTGAATGAGAAAATCATGAGGG - Intergenic
982291302 4:153785387-153785409 ACAGAGGTTTAAAATCATTATGG + Intronic
982512708 4:156303659-156303681 ACAGAACTATAAAGTGATGAAGG - Intergenic
982576053 4:157111485-157111507 ACAGCATAATATAATCATGAGGG - Intronic
982927588 4:161358313-161358335 ATAGAAATATAAAAACATCAAGG + Intergenic
983155191 4:164338315-164338337 AGAAAATTATAAAATCACAAAGG + Intronic
983387437 4:167082964-167082986 CAAGAATTATAAAATCACAATGG - Intronic
983587031 4:169366779-169366801 AAAGAGTTTTAAAAACATAATGG + Intergenic
983895928 4:173081687-173081709 ACACAATAAAAAAATGATAAAGG - Intergenic
983960963 4:173753652-173753674 ACATAATTATAAAATAATTTGGG - Intergenic
983984890 4:174046565-174046587 ACAGAAATAAAAGATTATAATGG + Intergenic
984301258 4:177921154-177921176 AGAGAATCATTAAATCACAAAGG - Intronic
984425247 4:179575494-179575516 AAAAAATTATCAAATCACAAAGG + Intergenic
984641291 4:182166888-182166910 AAAGACTTAGAATATCATAAAGG + Intronic
985204821 4:187524047-187524069 ACACAATAAAAAAATGATAAAGG + Intergenic
985221252 4:187707671-187707693 ACAAAATAAAAAAATAATAATGG + Intergenic
985278425 4:188261941-188261963 ACAGTATTTTAAAATCTTATGGG - Intergenic
985973110 5:3392865-3392887 ACAGAATTACAAAAACTTGAGGG - Intergenic
986265733 5:6188777-6188799 ACAGAGGAATAAACTCATAATGG + Intergenic
986846189 5:11757282-11757304 ACAACATGATAAATTCATAATGG - Intronic
987040293 5:14055854-14055876 ACAGAATTATAAAATAATATTGG + Intergenic
987171592 5:15264740-15264762 ACAAAATTATAATATCAACAAGG + Intergenic
987196065 5:15527446-15527468 ACTGAATTTAAAAATCATCATGG - Intronic
987485408 5:18519869-18519891 AAAGATTTATGAAATCATAGAGG - Intergenic
987570164 5:19646939-19646961 ACAGCATTTTAAAATCTGAACGG - Intronic
987579576 5:19772604-19772626 ACAAAATTAAAACAACATAATGG - Intronic
987788450 5:22532902-22532924 ACTCAATAATAAAAGCATAAAGG + Intronic
987869027 5:23588434-23588456 TCAGAATTAGAAAAAAATAATGG + Intergenic
988034294 5:25805940-25805962 AGAGTATTATATAATGATAAAGG - Intergenic
988092048 5:26555783-26555805 ACAGAATTAGAAAATAAAAATGG - Intergenic
988110118 5:26808493-26808515 AGAGAATAATAAAATTATACTGG + Intergenic
988203380 5:28099121-28099143 ACAGATATAAAAAATGATAAGGG - Intergenic
988214152 5:28249615-28249637 ACAGAATTCTAAAATAATAAAGG - Intergenic
988316032 5:29629323-29629345 ACAGAATTACAAAATGTTAGTGG - Intergenic
988437554 5:31193922-31193944 ACAGAATTAAAAAAAAAAAAAGG - Intronic
988570811 5:32363886-32363908 ACAGAAAAATAAAACCTTAATGG + Intronic
989158182 5:38364726-38364748 ACAGAAGTCTAAAATTATACTGG + Intronic
989359406 5:40583600-40583622 AAAAAATTTTAAAATAATAAAGG + Intergenic
989441070 5:41473210-41473232 ACAGTATTTCAAAATAATAAAGG + Intronic
989650921 5:43689051-43689073 ACATAATCAAAAAATAATAAAGG - Intronic
989729847 5:44635856-44635878 ACATAATTATAAATTAATTAGGG - Intergenic
990049613 5:51481490-51481512 ACGGACTTATAAAATCAAATTGG - Intergenic
990065116 5:51702713-51702735 ACACAATAAAAAAATAATAAAGG + Intergenic
990226370 5:53659858-53659880 ATAGAAGTATAAAGTCATACAGG - Intronic
990331660 5:54733116-54733138 ACAGAATTAGAGTATTATAAAGG - Intergenic
990631564 5:57675922-57675944 AAATAATGATATAATCATAAGGG - Intergenic
990756182 5:59073212-59073234 ACATAGTTATAAAATGATGAGGG + Intronic
990935452 5:61143113-61143135 ATATAATTATAAAATTATAATGG - Intronic
991162056 5:63514762-63514784 ACAGATTTATAAATGCAAAATGG + Intergenic
991334727 5:65534114-65534136 TCAAAATTATGAAATAATAAAGG + Intronic
991415252 5:66385593-66385615 ACACAATAAAAAAATGATAAAGG - Intergenic
991428126 5:66513043-66513065 AAAAAATTACAAAACCATAATGG + Intergenic
991724930 5:69526627-69526649 ACACAATTATAAATTTAGAAAGG + Intronic
992422824 5:76623754-76623776 ACATAATTATAAATTAATCATGG + Intronic
992587653 5:78257995-78258017 ATACAAATATAAAATCAAAATGG + Intronic
992739169 5:79755726-79755748 AAAGAATTCTAAAATGAAAAGGG - Intronic
993156324 5:84229130-84229152 ACACAATTATAAGAATATAATGG - Intronic
993209905 5:84934996-84935018 AAGGAATTATAAAATAATTAAGG - Intergenic
993220632 5:85092315-85092337 ACACAATAAAAAAATGATAAAGG + Intergenic
993236177 5:85312974-85312996 AGAGAAATATAATATGATAAAGG + Intergenic
993273680 5:85828696-85828718 ACAGCATTATAATCTCATCAAGG + Intergenic
993374991 5:87140322-87140344 AGAGAATAATAAAAAGATAAAGG + Intergenic
993410286 5:87565488-87565510 ACACAATAAAAAAATGATAAAGG - Intergenic
993613273 5:90080351-90080373 AGTGTATTATAAAAGCATAAAGG - Intergenic
993792803 5:92227914-92227936 AAAGAATAATAAAATAATATAGG - Intergenic
995482484 5:112607017-112607039 AAAGAAAAATAAAATCATACTGG + Intergenic
995826912 5:116310358-116310380 ACATAAAAATAAAATCAAAACGG - Intronic
996379823 5:122851766-122851788 AAAGAATTATAAAATATTGAAGG - Intronic
996878630 5:128268165-128268187 ACACAATAAAAAAATGATAAAGG + Intronic
996897354 5:128500944-128500966 ACAGAATTATATCATCACACAGG + Intronic
997890817 5:137674869-137674891 ACAGAATTTTCAAAGCCTAAAGG + Intronic
998085509 5:139319012-139319034 CCAGAAGTATAAAAGAATAAAGG + Exonic
998134864 5:139669259-139669281 GCATAATTAAAAAATCATTACGG - Intronic
998512419 5:142724571-142724593 ATAGATTTAAAAAATAATAAAGG - Intergenic
998574398 5:143298139-143298161 GCTGATTTATAAAATCTTAAAGG + Intronic
998675621 5:144404599-144404621 GCAGAAATATATAATTATAAAGG + Intronic
998751535 5:145327702-145327724 AAAAAATTATAAAGTCACAAAGG - Intergenic
998776763 5:145612260-145612282 AAAGACTTATATAATCTTAAAGG + Intronic
999467476 5:151821415-151821437 ACAGACTTACAAAAATATAACGG + Intergenic
999547483 5:152646344-152646366 AAAGAGTTATAAAATAATGATGG + Intergenic
999579606 5:153022309-153022331 ATAAACTTATCAAATCATAAGGG + Intergenic
999882327 5:155879712-155879734 ACATAATTATAACATCATAAAGG + Intronic
999963769 5:156786078-156786100 ACACAATAAAAAAATGATAAAGG + Intergenic
1000033879 5:157427600-157427622 ACACAATAAAAAAATGATAAAGG + Intronic
1000099368 5:158000385-158000407 AAAGATTAATAAAATCACAAAGG - Intergenic
1000142173 5:158416256-158416278 ACAGAATTATATATTCAAAATGG + Intergenic
1000454261 5:161429718-161429740 ACAGAATGCTAAAATTATAAGGG + Intronic
1000578002 5:162999957-162999979 ACAGAATTAGAAAATTACGATGG + Intergenic
1000711738 5:164588209-164588231 ACAGAATTATCAAACTCTAAGGG - Intergenic
1001576200 5:172765550-172765572 ACAGATTTATATAATCTTAAAGG + Intergenic
1002378303 5:178804972-178804994 ACAGGCTTCTAAAATAATAATGG + Intergenic
1002628445 5:180550540-180550562 ACAAAACTATAAAGTTATAAAGG - Intronic
1002695954 5:181089206-181089228 TCAGTATTATATAATGATAACGG + Intergenic
1003066164 6:2904799-2904821 AAAATATTATAAAATCAAAAGGG + Intergenic
1003346682 6:5275342-5275364 AAATAATGATAAAATCAGAAGGG - Intronic
1005037091 6:21566475-21566497 AAAGAATTATATAATGATAAAGG - Intergenic
1005120724 6:22386828-22386850 ACACAATAAAAAAATGATAAAGG - Intergenic
1005287123 6:24339688-24339710 ACAGAATTATAAAATCATAATGG - Intronic
1005416154 6:25602518-25602540 AAACAAATATAAAACCATAAGGG - Intronic
1005425040 6:25693718-25693740 AGAGAATTTTATAATCAGAAAGG - Intronic
1005707782 6:28473021-28473043 ACAGAATTTTAAAATAATTAGGG - Intergenic
1006815893 6:36849553-36849575 ATACTATTATAAAATCATAGAGG + Intergenic
1006999175 6:38292667-38292689 ACACAATAAAAAAATGATAAAGG - Intronic
1007212223 6:40203874-40203896 AGAGAATTATCACATCACAAAGG - Intergenic
1008029324 6:46675749-46675771 AAGGAATTATAAAAGAATAAGGG - Intronic
1008168761 6:48175460-48175482 TAAAAATTATAAAATCAAAAAGG - Intergenic
1008190367 6:48448544-48448566 ACATAATTATGAAATTAAAATGG - Intergenic
1008947015 6:57109642-57109664 ACAGCCTTAAAAAATCATAAAGG - Intronic
1009004021 6:57759456-57759478 CCAGCATTATAACATCATACAGG + Intergenic
1009193255 6:60654810-60654832 ACACAATAAAAAAATGATAAAGG - Intergenic
1009297223 6:61967078-61967100 AGATAATTTTAAAATTATAAAGG - Intronic
1009622093 6:66090533-66090555 AGTGATTTATAAAATCAAAATGG - Intergenic
1009706868 6:67263471-67263493 ACACAATAAAAAAATGATAAAGG - Intergenic
1009742255 6:67760715-67760737 AAAAAATTATAAAATGAAAAAGG + Intergenic
1010070051 6:71733397-71733419 ATAGTATTATAAAACTATAAAGG + Intergenic
1010638387 6:78288663-78288685 ACATCATTATATAATAATAAAGG - Intergenic
1010850502 6:80770444-80770466 ACACAATTATAAAATCTTTAAGG + Intergenic
1011084415 6:83523423-83523445 ACAAAATTAGAAGATCAAAATGG + Exonic
1011339924 6:86302899-86302921 ACACAATAAAAAAGTCATAAAGG - Intergenic
1011584181 6:88906929-88906951 ATAGAAATATAAATTCATATGGG + Intronic
1011709445 6:90037390-90037412 ACACAACTATAAAATCATGAAGG + Intronic
1011776025 6:90731524-90731546 ACATAATTAAATAATTATAATGG + Intergenic
1011846068 6:91564256-91564278 ACTTAGTTATAAAATAATAATGG + Intergenic
1011959681 6:93071896-93071918 ATAGTTTTATAATATCATAAAGG - Intergenic
1012214810 6:96570284-96570306 ATAGAGTTATAAACTCAAAATGG - Intronic
1012275385 6:97267892-97267914 ACAGGCTTATTAAATCACAAAGG + Exonic
1012392916 6:98763435-98763457 ACACAATAAAAAAATGATAAAGG + Intergenic
1012740884 6:103015366-103015388 ACACAATAAAAAAATGATAAAGG - Intergenic
1012843678 6:104362579-104362601 ACAGAATTATTACATCATAAAGG + Intergenic
1012871185 6:104674361-104674383 ACACAATAAAAAAATGATAAAGG + Intergenic
1013596716 6:111667013-111667035 AAAGGATAATATAATCATAATGG - Intronic
1014223237 6:118819970-118819992 ACACAATAAAAAAATGATAAAGG - Intronic
1014408264 6:121079905-121079927 AAAGAATTATAAATTGATATGGG + Intronic
1014470345 6:121805935-121805957 AGAAAATTATAAAATAGTAATGG - Intergenic
1014516221 6:122381842-122381864 AAAGAATTATAAAAACATAAAGG + Intergenic
1015077983 6:129186261-129186283 AATAAATTATAGAATCATAAAGG + Intronic
1015158412 6:130124527-130124549 ACTGAATCAAAAAATCAAAAAGG - Intronic
1015261431 6:131241998-131242020 ACAGAATTTAAACTTCATAAAGG - Intronic
1015290076 6:131529013-131529035 ACACAATAAAAAAATGATAAAGG - Intergenic
1015379781 6:132553415-132553437 AGAGAGTTATAAAATCAGAGTGG + Exonic
1015852785 6:137591341-137591363 AAAGCATTATATAATGATAAAGG + Intergenic
1016107149 6:140177026-140177048 ACAGAGTTATAAATTGTTAACGG - Intergenic
1016132007 6:140485537-140485559 ACATAATAATAAGATCAAAAGGG + Intergenic
1016691363 6:146941781-146941803 ACACAATAAAAAAATGATAAAGG - Intergenic
1016935140 6:149444028-149444050 ATAGAATTAGCAAATCACAATGG - Intergenic
1017691778 6:156973389-156973411 ACAGAATTTGAGAATCAGAAGGG - Intronic
1017945147 6:159090541-159090563 ACAGAGTTATAATATAATAAAGG - Intergenic
1018552550 6:165014602-165014624 ACATAATTATGAAACCATCATGG - Intergenic
1018559031 6:165082142-165082164 ACAGAATCACAGAATCAAAACGG + Intergenic
1018569240 6:165190164-165190186 ACACAATAAGAAAATAATAAAGG - Intergenic
1019843338 7:3472235-3472257 ACAAAATTATAAAAGCACTATGG - Intronic
1020938461 7:14499563-14499585 TCATAATCATAAAATCACAAAGG + Intronic
1021014965 7:15520987-15521009 ACACAATAAAAAAATGATAAAGG + Intronic
1021160628 7:17268952-17268974 ACAACATTATAAAATCACAAAGG - Intergenic
1021342778 7:19485602-19485624 AAAGATTTATAAAATAAGAAGGG - Intergenic
1021590430 7:22255142-22255164 ACAGGATTATAAGGTCATATAGG + Intronic
1021962977 7:25891116-25891138 ACAGAACTAAAAAATGGTAAAGG - Intergenic
1022061064 7:26795684-26795706 ACAGTCTTATAAAATGATAAGGG + Intronic
1022289718 7:28989278-28989300 ACAAAATAATTAAATCATCATGG + Intergenic
1022351193 7:29566851-29566873 CCAGAAAAATAAAATCATGAAGG - Exonic
1022574766 7:31486823-31486845 ACAGTATTATAAAATAGAAAGGG - Intergenic
1022736711 7:33082889-33082911 ACAGAAATATCAAAACAAAAGGG - Intergenic
1023903134 7:44499847-44499869 ACAGGATTATATAAGAATAACGG + Intergenic
1024136872 7:46417826-46417848 ACAGAATGATGAAAATATAAAGG + Intergenic
1024146760 7:46524573-46524595 ACACAAATATCAAACCATAAAGG - Intergenic
1024495818 7:50044459-50044481 ACACAATAAAAAAATAATAAAGG + Intronic
1024878092 7:54049892-54049914 ACATAATTACACAATGATAAAGG - Intergenic
1025166405 7:56716115-56716137 AAAAAATAATAAAATAATAAGGG + Intergenic
1025740952 7:64195053-64195075 ACACAGTTATCAAATCAGAAAGG - Intronic
1025741676 7:64202742-64202764 ACACAGTTATCAAATCAGAAAGG + Intronic
1025858042 7:65301476-65301498 ACAGAAATATTAAACTATAATGG + Intergenic
1025989742 7:66487918-66487940 ACAATATAATAAAAACATAATGG + Intergenic
1027519299 7:79183619-79183641 GCATAATTAAAAAATAATAATGG - Intronic
1027618935 7:80458963-80458985 AAAGTATTGCAAAATCATAAAGG + Intronic
1027684176 7:81261160-81261182 CCAGCATTATAATATCATATAGG + Intergenic
1028601918 7:92610461-92610483 ACAGAAATGTAAAAACAGAAGGG - Exonic
1028783991 7:94771481-94771503 ATAGAATTTTAAAATAATACTGG + Intergenic
1029013679 7:97291276-97291298 ACAAAATTTTAAAAGTATAAAGG + Intergenic
1029053133 7:97710797-97710819 ACACAATAAAAAAATGATAAAGG + Intergenic
1029919464 7:104247261-104247283 ACACAATAAAAAAATGATAAAGG - Intergenic
1030182498 7:106724904-106724926 ACACAATAAAAAAATGATAAAGG + Intergenic
1030232926 7:107226719-107226741 ACAGAAGTATAATATATTAAGGG - Intronic
1030395339 7:108979371-108979393 ACACAATTTAAAAATGATAAAGG - Intergenic
1030510625 7:110478477-110478499 ATATAATTAAAAAATCAAAAAGG + Intergenic
1030538714 7:110802476-110802498 ATAAAATTACAAAATAATAATGG - Intronic
1030644920 7:112049768-112049790 GCACAATGATAAAATCATCAAGG + Intronic
1030947923 7:115749767-115749789 AAGGACTTATAAAAACATAATGG - Intergenic
1031107640 7:117565272-117565294 ATACAATTATAATCTCATAAGGG - Intronic
1031215768 7:118888607-118888629 ACACAAAAATAAAATCAAAATGG + Intergenic
1031238230 7:119204931-119204953 ACAGAATTATTACATGATTATGG - Intergenic
1031439085 7:121770956-121770978 ACACAATTATAAACTCATAATGG - Intergenic
1031481328 7:122281766-122281788 ACACAATAAAAAAATGATAAAGG - Intergenic
1031492630 7:122407699-122407721 ACAAAAGGATAAAAACATAAAGG + Intronic
1031550953 7:123110994-123111016 ACAGAACTTTAAGATAATAATGG - Intergenic
1031658000 7:124381596-124381618 ACAAAATAAAAAAATAATAAAGG + Intergenic
1032314857 7:130827742-130827764 AAAAAATTATCAAATGATAAAGG - Intergenic
1032351526 7:131168376-131168398 ACACAATTATGAAACAATAAAGG + Intronic
1033494353 7:141878935-141878957 ACAGACTTACATAATAATAAAGG - Intergenic
1033978700 7:147135963-147135985 ACAGTATTATAATATTATAATGG + Intronic
1034907296 7:154961257-154961279 ACAGAATTACAAAACCACTAAGG + Intronic
1035126815 7:156613924-156613946 ATAGAATTGTAAAATTTTAAAGG + Intergenic
1035814412 8:2523793-2523815 ACAGAATTATAAAAGAATTCAGG - Intergenic
1035879348 8:3227542-3227564 ACTTAATTATACAATAATAAGGG + Intronic
1035896538 8:3409071-3409093 ACAGCATTATTAAGTCACAAAGG + Intronic
1036194620 8:6703035-6703057 ACAGTATTGAAAAATCACAATGG + Intergenic
1036403734 8:8434482-8434504 ACACAAATATAAATTCATAAAGG - Intergenic
1036531363 8:9591153-9591175 ACAGAAATAAAAGATTATAAAGG - Intronic
1036606574 8:10310886-10310908 ATAGGATTATAAAATTGTAATGG - Intronic
1037006094 8:13782213-13782235 ACAGGATAATAAAATCTTGAAGG - Intergenic
1037179644 8:15990102-15990124 AAACACTTATAAAATCATCAGGG + Intergenic
1037918847 8:22789903-22789925 ACAGAATTACCAAATCAACATGG - Intronic
1037951580 8:23021951-23021973 ACAGAATTATAAAAGTAGAAAGG + Exonic
1038148981 8:24925436-24925458 TCAGAATCATAAAACCCTAAAGG + Intergenic
1038231007 8:25700149-25700171 ACCCATTTAAAAAATCATAAAGG + Intergenic
1038378538 8:27069028-27069050 ACACAAAAATAAAATCAAAATGG + Intergenic
1038810721 8:30839474-30839496 AAAGACTTCTAAAATCAAAAAGG - Intronic
1038819532 8:30939676-30939698 ACAGAATTAAGGAATCATAGGGG + Intergenic
1039312903 8:36338254-36338276 TAATAATTAAAAAATCATAAAGG + Intergenic
1039591781 8:38756120-38756142 AGAGAATTATAAAATAAGATTGG + Intronic
1039685629 8:39798890-39798912 ACACAATAAAAAAATGATAAAGG - Intronic
1039876561 8:41591321-41591343 AAAGAAGTATAAAATCTAAAAGG - Intronic
1040738618 8:50543233-50543255 ACACAAAAATAAAATCAAAATGG - Intronic
1040788820 8:51200801-51200823 AGAGCATTTTACAATCATAAGGG - Intergenic
1040857702 8:51966766-51966788 ACATAATTACATAATGATAAAGG + Intergenic
1041185319 8:55294124-55294146 TCAGAATTGTAAAATCATAATGG - Intronic
1042171466 8:65995626-65995648 ACACAATAAAAAAATGATAAAGG - Intergenic
1042314029 8:67406687-67406709 CCACAATTGTAAAATCAGAATGG - Intergenic
1042504473 8:69545058-69545080 AAAAAATTATAAAAAGATAAAGG + Intronic
1043092794 8:75926283-75926305 AGGGCATTACAAAATCATAAAGG + Intergenic
1043296886 8:78675884-78675906 ACAGATCTGTAAAACCATAAAGG - Intronic
1043694095 8:83198010-83198032 ACTGAATTTTCAAAACATAATGG + Intergenic
1043718875 8:83518979-83519001 ACAAAATTATAAAATAAAAGAGG + Intergenic
1043994973 8:86802383-86802405 AGAAATCTATAAAATCATAAAGG - Intergenic
1044189008 8:89291918-89291940 AGTTACTTATAAAATCATAATGG + Intergenic
1044947761 8:97407049-97407071 AAAGAATTAAAAAAAAATAAAGG - Intergenic
1045157531 8:99493205-99493227 ACAGAATTATATACTTAAAATGG - Intronic
1045578115 8:103447992-103448014 ACAGAATCATAAAATCATCCAGG - Intergenic
1045612203 8:103858793-103858815 ACAGAATTATAAGATTATACTGG + Intronic
1045839642 8:106564275-106564297 ACACAATAAAAAAATGATAAAGG + Intronic
1046272320 8:111913133-111913155 ACACAATTAGAAAATAGTAAGGG - Intergenic
1046360125 8:113142088-113142110 CCAAAATTATAAAATGCTAATGG + Intronic
1046714522 8:117552875-117552897 AAAAAATTATAAAATAATATTGG + Intergenic
1046753496 8:117949372-117949394 AGAGCATTAAAAAATAATAATGG + Intronic
1046880575 8:119302708-119302730 ACAAAATTATCTAATCACAAAGG + Intergenic
1046977403 8:120296696-120296718 ACATAATTACAACATCATTAAGG - Intronic
1047139065 8:122115489-122115511 ATATAACTATAAAATCACAAAGG - Intergenic
1047980495 8:130176359-130176381 ACAGAAGTAGAAAAGAATAAAGG + Intronic
1047984951 8:130223118-130223140 AAAAAATTATAAAACCACAAAGG + Intronic
1048400119 8:134057761-134057783 ACACAATTAGTAAATGATAATGG - Intergenic
1048514039 8:135088941-135088963 ACAGAACTGTGAAATAATAAAGG + Intergenic
1050166867 9:2774071-2774093 ACACAATTAAGAAATGATAAAGG + Intronic
1050242789 9:3656040-3656062 ACATCATTATATAATGATAAAGG - Intergenic
1050281726 9:4057256-4057278 TAAGAATTTTAAAATGATAATGG - Intronic
1050300188 9:4250465-4250487 ACACAATAAAAAAATGATAAAGG - Intronic
1051046069 9:12875030-12875052 ACAGAAAAATAAACTCAAAATGG + Intergenic
1051279216 9:15424581-15424603 ACAAAATTATTCAATGATAATGG + Intronic
1051620600 9:19046361-19046383 ACAGAAATAGAAAATAAGAAAGG + Intronic
1051777583 9:20652637-20652659 ACATAATTATAATATAATAATGG - Intergenic
1051836469 9:21343884-21343906 ACACAATAAAAAAATGATAAAGG + Intergenic
1052167144 9:25345676-25345698 ACATAATTATTAAATCAAAAAGG - Intergenic
1055607379 9:77984907-77984929 AGAGAATTACAAAATCAAAATGG + Intronic
1055712944 9:79085158-79085180 AGAGAACAAGAAAATCATAAAGG + Intergenic
1055832424 9:80397090-80397112 TCAAAATTATAAAATGCTAAGGG - Intergenic
1055840661 9:80499216-80499238 TCAGAATTATAAAATATTAGAGG + Intergenic
1055881394 9:81008994-81009016 ACATAATAATAAACTCAAAATGG + Intergenic
1056003229 9:82239848-82239870 ACACAATAAAAAAATGATAAAGG - Intergenic
1056223680 9:84474079-84474101 ACACAACTACAAAATCTTAATGG + Intergenic
1056281760 9:85048314-85048336 ACAAAATTATAAAATGATTAAGG - Intergenic
1056460805 9:86808090-86808112 ACAGAATTAGCAAATCAGACAGG - Intergenic
1056977681 9:91274492-91274514 ACTGTATTGTAAAATCCTAAAGG - Intronic
1057511423 9:95682612-95682634 ACAGAAAAACAAAATCAAAATGG + Intergenic
1057993997 9:99802978-99803000 CTAGAATTATGAAATCAAAAGGG + Intergenic
1058003099 9:99887180-99887202 ACAGAATTTTAAAAACACAGGGG + Intergenic
1058026728 9:100148182-100148204 ACAGAAATAAAAAACCAAAAAGG + Intronic
1058061627 9:100503014-100503036 ACAGATTTATAATCTTATAAAGG - Intronic
1058298468 9:103339712-103339734 ACAGAAAAATAAGGTCATAAAGG + Intergenic
1058353431 9:104054546-104054568 ACACAATAAAAAAATGATAAAGG + Intergenic
1058639450 9:107068720-107068742 ACACACTCATAAACTCATAAAGG + Intergenic
1058819526 9:108716743-108716765 ACACAATAAAAAAATGATAAAGG + Intergenic
1058856816 9:109070467-109070489 ACAGATTTATAAGGTCTTAAGGG - Intronic
1059396444 9:114036916-114036938 ACAGAATCAGAAATTCACAATGG - Intronic
1059518216 9:114915289-114915311 AAAGAATTATAGTCTCATAAAGG + Intronic
1059889211 9:118782634-118782656 TCAGAGATATAAAAACATAATGG - Intergenic
1060367825 9:123036850-123036872 GAAGAATTATAAAATCCTATAGG - Intronic
1203442236 Un_GL000219v1:20372-20394 ACACAATAAAAAAATGATAAAGG - Intergenic
1203513044 Un_KI270741v1:139281-139303 ACACAATAAAAAAATGATAAAGG - Intergenic
1185712555 X:2315668-2315690 ACAGAACTGTGAGATCATAAAGG - Intronic
1186097050 X:6113606-6113628 CCAGAATTATAACATCCTAAGGG + Intronic
1186158993 X:6756774-6756796 ACATAATTATATAATCAGAGGGG + Intergenic
1186652107 X:11572139-11572161 TCAGGATAATCAAATCATAATGG + Intronic
1186970711 X:14839609-14839631 ATTGAATTATAAACTCAAAAAGG + Intergenic
1187001831 X:15188696-15188718 ACAGAAAAATAGAAACATAATGG - Intergenic
1187218517 X:17300313-17300335 CCAGCATCATAAGATCATAAGGG - Intergenic
1187267610 X:17749750-17749772 GAAGAATTATATAATCAAAAGGG + Intronic
1188019908 X:25145697-25145719 ACAATATTATAAAATCACAATGG - Intergenic
1188037620 X:25336264-25336286 ACACAATAAAAAAATGATAAAGG - Intergenic
1188133228 X:26463812-26463834 ACAGTATTATAAAATTAACATGG - Intergenic
1188301387 X:28508137-28508159 ACAGTATTAAAAAAAAATAACGG + Intergenic
1188356312 X:29196063-29196085 GCAGAAATTTAAAATCATCATGG - Intronic
1188697468 X:33213376-33213398 CCTGGATTATAAAATCTTAAGGG - Intronic
1188714116 X:33439908-33439930 ACACAAATATTAAATCAAAATGG + Intergenic
1188790250 X:34400309-34400331 ACAGAATTATAAAATTATAAAGG - Intergenic
1188864879 X:35302561-35302583 AAGGAATTATATAATGATAAAGG + Intergenic
1189159113 X:38792475-38792497 ACAGAAGGATAAATTCACAATGG + Intergenic
1189528475 X:41852897-41852919 ACAGAGTTATAAAATCATCTAGG - Intronic
1189574799 X:42340207-42340229 ACACAATAAAAAAATGATAAAGG - Intergenic
1189863829 X:45301998-45302020 ACACAAATATCAAATCAGAAAGG - Intergenic
1190406581 X:50093943-50093965 ACAGAGCTATAAAATCATCCAGG - Exonic
1190435723 X:50422808-50422830 TCAGAATTATTTAAACATAAAGG + Intronic
1191150304 X:57214038-57214060 ACACAATTATATAATAATAAAGG - Intergenic
1191632200 X:63333691-63333713 ACACAATAAAAAAATAATAAAGG + Intergenic
1191685687 X:63887332-63887354 ACAGCATTACATAATTATAAAGG + Intergenic
1191957011 X:66653227-66653249 AAAGCATTATATAATGATAAAGG + Intergenic
1192043939 X:67652152-67652174 ATAGAATTAAAAAGTCATAGAGG + Intronic
1192723864 X:73727701-73727723 AAAGAATTTTAAAATGAAAATGG + Intergenic
1192838884 X:74833341-74833363 ACATCATTATATAATGATAAAGG - Intronic
1192883286 X:75310693-75310715 ACACAATAAAAAAATGATAAAGG - Intergenic
1193166945 X:78291812-78291834 ACACAATTAAAAAACAATAAAGG - Intronic
1193179733 X:78440739-78440761 ACAGAAATATCAAACCAGAAAGG + Intergenic
1193429775 X:81387129-81387151 ACACAATAAGAAAATGATAAAGG - Intergenic
1193555393 X:82947853-82947875 ACACAATAAAAAAATGATAAAGG + Intergenic
1193671691 X:84395484-84395506 AGAGAATTCTAAAAACATTAAGG - Intronic
1193855354 X:86594151-86594173 AAACAATTTTAAAATAATAAAGG - Intronic
1193855390 X:86595008-86595030 AGGGAATTAAAAAATGATAAAGG - Intronic
1194085734 X:89525897-89525919 AGAGAATTATAAATGCATACAGG + Intergenic
1194230854 X:91321856-91321878 ACACAATAAAAAAATGATAAAGG + Intergenic
1194462455 X:94188577-94188599 ACAGAATAGAAAAATCAGAATGG - Intergenic
1194656008 X:96574314-96574336 AAAGAATTATAATATCATCAAGG - Intergenic
1194860186 X:98990199-98990221 ACAGACTAATAAAATTAGAAAGG - Intergenic
1194991640 X:100553420-100553442 ACACAATAAAAAAATGATAAAGG + Intergenic
1195103467 X:101579568-101579590 ACGGCATTATATAATGATAAAGG - Intergenic
1195210425 X:102649190-102649212 ACATAATTATAAAACAGTAAAGG + Intergenic
1195558443 X:106254889-106254911 AAAGAATTAGAAAATTAAAAGGG - Intergenic
1195661081 X:107378873-107378895 ACACAATAAAAAAATGATAAAGG - Intergenic
1195848255 X:109253140-109253162 AGAAAATTATCAAATCACAAAGG - Intergenic
1196217309 X:113068868-113068890 AGAGAATTATATAATGATAAGGG - Intergenic
1196344874 X:114642911-114642933 AGATAATTATAAAATCATTGGGG - Intronic
1196362372 X:114878191-114878213 AGATTATTATAAAATGATAAAGG - Intronic
1196403515 X:115340739-115340761 ATATAATTATGAAATCAGAAAGG - Intergenic
1197070991 X:122297423-122297445 ACACAATAAAAAAATGATAAAGG - Intergenic
1197261047 X:124318467-124318489 ACACAAAAATAAAATCAAAATGG + Intronic
1197319350 X:125008286-125008308 AGGGCATTATATAATCATAAAGG + Intergenic
1197426838 X:126307378-126307400 GAAGAATTATATCATCATAAAGG + Intergenic
1197535111 X:127677514-127677536 ATAGAAATAAAACATCATAAAGG + Intergenic
1197548647 X:127860605-127860627 ACACTATTTTAAACTCATAATGG - Intergenic
1197565110 X:128074249-128074271 ACAGCATTACATAATAATAAAGG + Intergenic
1197611167 X:128639933-128639955 ACAGTATGCTAAAATCATAAAGG + Intergenic
1198072391 X:133161756-133161778 ACAGAATTACATAATGCTAAAGG + Intergenic
1198366787 X:135948450-135948472 GCAGAAGAATAAAATCATTATGG + Intergenic
1198675935 X:139130306-139130328 ATAAAATTATACAATCATAATGG - Intronic
1198834500 X:140788288-140788310 ATAAAATTATTAAATAATAATGG - Intergenic
1198878396 X:141251974-141251996 ACACAATAAAAAAATGATAAAGG - Intergenic
1199048072 X:143201337-143201359 ACACCATTATATAATGATAAGGG - Intergenic
1199324315 X:146478480-146478502 ACAGAATTTAAAAATTATAAAGG - Intergenic
1199385915 X:147223089-147223111 ACACAATAAAAAAATGATAAAGG + Intergenic
1199751168 X:150819688-150819710 AGAGAAATAAAAAATTATAAAGG + Intronic
1199909373 X:152269828-152269850 ACACAATAATAAAATCAAAATGG + Intronic
1199934308 X:152556364-152556386 AATGAAATATAAAAACATAATGG - Intergenic
1200380262 X:155829907-155829929 ACAGTATTACATAATAATAAAGG + Intergenic
1200438383 Y:3181781-3181803 AGAGAATTATAAATGCATACAGG + Intergenic
1200717054 Y:6558969-6558991 AGATAATTATACAATGATAAAGG + Intergenic
1200731597 Y:6748826-6748848 ACACAATAAAAAAATGATAAAGG - Intergenic
1200770331 Y:7119159-7119181 GCTGAATAATAAAATCTTAATGG - Intergenic
1200855957 Y:7938575-7938597 GCAGGATTATTAAATCATATGGG + Intergenic
1200856326 Y:7942494-7942516 ACAGAATTATTACATCACTAAGG + Intergenic
1200867909 Y:8065106-8065128 ACAAAATTATTAAATCATTCAGG - Intergenic
1201251257 Y:12060366-12060388 GAAGAAATATAAAATGATAAAGG + Intergenic
1201258888 Y:12138138-12138160 ACACAAATAAAAAATGATAAAGG + Intergenic
1201419212 Y:13779702-13779724 ACACAATAAAAAAATGATAAAGG - Intergenic
1201421992 Y:13809563-13809585 ACACAATAAAAAAATGATAAAGG - Intergenic
1201502157 Y:14656805-14656827 CTAGAATTATAACATCCTAAGGG - Intronic
1201521981 Y:14885390-14885412 ATAGATAGATAAAATCATAAAGG - Intergenic
1201608918 Y:15818522-15818544 AAGGAATTATAAAATGATAAAGG + Intergenic
1201651960 Y:16298671-16298693 ACACAATAAAAAAATGATAAGGG + Intergenic
1201709512 Y:16974824-16974846 GCAGAACTATATCATCATAATGG - Intergenic
1201940183 Y:19450649-19450671 ACATAATGATAAAATCAAAGTGG + Intergenic
1202050225 Y:20773194-20773216 AGAAAAATAGAAAATCATAATGG - Intronic
1202102274 Y:21322598-21322620 ACAGAATTAGCCAAGCATAACGG - Intergenic
1202263011 Y:22989387-22989409 GCAGAATTATTAAATCACTAAGG - Intronic
1202416001 Y:24623128-24623150 GCAGAATTATTAAATCACTAAGG - Intronic
1202454473 Y:25043821-25043843 ACACAAGAGTAAAATCATAAAGG + Intronic
1202454786 Y:25046958-25046980 GCAGAATTATTAAATCACTAAGG + Intronic