ID: 1005287125

View in Genome Browser
Species Human (GRCh38)
Location 6:24339720-24339742
Sequence CAGAGTAATTACATGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005287123_1005287125 9 Left 1005287123 6:24339688-24339710 CCATTATGATTTTATAATTCTGT 0: 1
1: 1
2: 7
3: 83
4: 886
Right 1005287125 6:24339720-24339742 CAGAGTAATTACATGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005287125 Original CRISPR CAGAGTAATTACATGGTGCC TGG Intronic
No off target data available for this crispr