ID: 1005288991

View in Genome Browser
Species Human (GRCh38)
Location 6:24359992-24360014
Sequence AGCTCGGGCGCCGGCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005288975_1005288991 25 Left 1005288975 6:24359944-24359966 CCTCCGCCGTAGTACCTACCGAC No data
Right 1005288991 6:24359992-24360014 AGCTCGGGCGCCGGCCGCGCGGG No data
1005288976_1005288991 22 Left 1005288976 6:24359947-24359969 CCGCCGTAGTACCTACCGACACT No data
Right 1005288991 6:24359992-24360014 AGCTCGGGCGCCGGCCGCGCGGG No data
1005288980_1005288991 7 Left 1005288980 6:24359962-24359984 CCGACACTCGCGTGCTGGAGAGG No data
Right 1005288991 6:24359992-24360014 AGCTCGGGCGCCGGCCGCGCGGG No data
1005288974_1005288991 26 Left 1005288974 6:24359943-24359965 CCCTCCGCCGTAGTACCTACCGA No data
Right 1005288991 6:24359992-24360014 AGCTCGGGCGCCGGCCGCGCGGG No data
1005288979_1005288991 11 Left 1005288979 6:24359958-24359980 CCTACCGACACTCGCGTGCTGGA No data
Right 1005288991 6:24359992-24360014 AGCTCGGGCGCCGGCCGCGCGGG No data
1005288977_1005288991 19 Left 1005288977 6:24359950-24359972 CCGTAGTACCTACCGACACTCGC No data
Right 1005288991 6:24359992-24360014 AGCTCGGGCGCCGGCCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005288991 Original CRISPR AGCTCGGGCGCCGGCCGCGC GGG Intergenic