ID: 1005292317

View in Genome Browser
Species Human (GRCh38)
Location 6:24391971-24391993
Sequence ATCCTCCCACATCAAAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005292315_1005292317 -8 Left 1005292315 6:24391956-24391978 CCATGACAGAGAACCATCCTCCC No data
Right 1005292317 6:24391971-24391993 ATCCTCCCACATCAAAGCTGAGG No data
1005292314_1005292317 6 Left 1005292314 6:24391942-24391964 CCAGACTTCTAAAACCATGACAG No data
Right 1005292317 6:24391971-24391993 ATCCTCCCACATCAAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005292317 Original CRISPR ATCCTCCCACATCAAAGCTG AGG Intergenic
No off target data available for this crispr