ID: 1005295729

View in Genome Browser
Species Human (GRCh38)
Location 6:24424942-24424964
Sequence CCATGACCACACACAGGAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005295729_1005295741 27 Left 1005295729 6:24424942-24424964 CCCACTCCTGTGTGTGGTCATGG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 1005295741 6:24424992-24425014 AGAATGGAACAGGACAGGCTGGG 0: 1
1: 1
2: 6
3: 149
4: 640
1005295729_1005295738 17 Left 1005295729 6:24424942-24424964 CCCACTCCTGTGTGTGGTCATGG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 1005295738 6:24424982-24425004 GCTGCAGAACAGAATGGAACAGG 0: 1
1: 0
2: 4
3: 20
4: 207
1005295729_1005295739 22 Left 1005295729 6:24424942-24424964 CCCACTCCTGTGTGTGGTCATGG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 1005295739 6:24424987-24425009 AGAACAGAATGGAACAGGACAGG 0: 1
1: 2
2: 60
3: 198
4: 751
1005295729_1005295735 -8 Left 1005295729 6:24424942-24424964 CCCACTCCTGTGTGTGGTCATGG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 1005295735 6:24424957-24424979 GGTCATGGGAAGCCATTAGAGGG 0: 1
1: 0
2: 5
3: 38
4: 300
1005295729_1005295737 11 Left 1005295729 6:24424942-24424964 CCCACTCCTGTGTGTGGTCATGG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 1005295737 6:24424976-24424998 AGGGAAGCTGCAGAACAGAATGG 0: 1
1: 0
2: 1
3: 55
4: 561
1005295729_1005295740 26 Left 1005295729 6:24424942-24424964 CCCACTCCTGTGTGTGGTCATGG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 1005295740 6:24424991-24425013 CAGAATGGAACAGGACAGGCTGG 0: 1
1: 1
2: 4
3: 43
4: 390
1005295729_1005295734 -9 Left 1005295729 6:24424942-24424964 CCCACTCCTGTGTGTGGTCATGG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 1005295734 6:24424956-24424978 TGGTCATGGGAAGCCATTAGAGG 0: 1
1: 0
2: 0
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005295729 Original CRISPR CCATGACCACACACAGGAGT GGG (reversed) Exonic
900138204 1:1127705-1127727 CCCTGACACCACACAGGAGCCGG - Intergenic
900247910 1:1647560-1647582 CCCTGTCCACACACAGCCGTGGG - Intronic
900259136 1:1714715-1714737 CCCTGTCCACACACAGCCGTGGG - Intronic
900285612 1:1898599-1898621 GCATGTGCACACACATGAGTTGG + Intergenic
900358902 1:2278607-2278629 CCATGGGAAGACACAGGAGTTGG - Intronic
900397803 1:2460364-2460386 CCATGCCCACACACAGCAGGTGG + Intronic
901008547 1:6183988-6184010 CCAAGACCTCCCACAGGAGAGGG - Intronic
901236904 1:7672082-7672104 CCCTGACCATAAACAGGAGGGGG + Intronic
904455285 1:30644103-30644125 CCAAGTCCACACACAGGGTTAGG + Intergenic
906842568 1:49155777-49155799 CCAAGACCACATTCAGGAATAGG - Intronic
908455832 1:64304073-64304095 CCATGACCATTCACAGTAATGGG + Intergenic
908487112 1:64605686-64605708 CCAAGACCACCCACATCAGTGGG + Intronic
910745620 1:90571021-90571043 CCATGACCAGAAAGAGAAGTTGG - Intergenic
911407900 1:97464969-97464991 CCATGAACACAGCCAGGAGGAGG + Intronic
913667477 1:121061440-121061462 CCAGGACCACACATAAGAGCCGG - Intergenic
914019170 1:143848583-143848605 CCAGGACCACACATAAGAGCCGG - Intergenic
914657719 1:149756790-149756812 CCAGGACCACACATAAGAGCCGG - Intergenic
915283231 1:154836859-154836881 CCATCACCTCACAGAGGACTTGG + Intronic
915494287 1:156270387-156270409 CTAAGACCACACAGAGGAGAGGG + Intronic
915811787 1:158920718-158920740 CCATGAAAACAGCCAGGAGTGGG + Intergenic
916910513 1:169341173-169341195 CCAGGGCCACACAGAGCAGTGGG - Intronic
917585118 1:176418058-176418080 CCATTATCAATCACAGGAGTGGG - Intergenic
919289305 1:195609157-195609179 ACATGAACATACACAGGAATAGG - Intergenic
919815411 1:201435034-201435056 CCTTGACCACACAAAGCATTGGG + Intergenic
924036522 1:239943762-239943784 CCATGAAAACAGCCAGGAGTGGG - Intergenic
1062939283 10:1409633-1409655 CCATGACCACAGCCAGGCCTCGG - Intronic
1062939388 10:1410145-1410167 CCATGACCACAGCCAGGCCTTGG - Intronic
1065365926 10:24936869-24936891 CTCTGACCACACACAGTTGTGGG + Intronic
1067037043 10:42928289-42928311 CCAGCACCACACACAGCTGTGGG + Intergenic
1067451780 10:46386200-46386222 CCATGAGTACACACAGGGTTGGG - Intronic
1067585458 10:47473555-47473577 CCATGAGTACACACAGGGTTGGG + Intronic
1067906298 10:50294723-50294745 CCATTACCACACACACCACTGGG + Intergenic
1068222001 10:54057088-54057110 CCATGAAAACAACCAGGAGTGGG - Intronic
1070472924 10:76801718-76801740 GAATGATCACAGACAGGAGTAGG + Intergenic
1070628694 10:78069129-78069151 CCATGCCCCCACACAGAAGGTGG - Intergenic
1073064357 10:100749579-100749601 CCACGACCACGCGGAGGAGTGGG - Intronic
1074817032 10:117150145-117150167 CCAAAACCACACACTGGATTTGG - Intergenic
1075737977 10:124675743-124675765 CCAGGACCAAGCACAGCAGTGGG + Intronic
1075959058 10:126551301-126551323 CCAAGTCCACACAGAGGTGTTGG - Intronic
1076231907 10:128826973-128826995 AAATGACCACAGAAAGGAGTAGG + Intergenic
1076432226 10:130412429-130412451 CCGTGAACACACACACGACTGGG - Intergenic
1077158542 11:1102280-1102302 CCGTGCCCACGCACAGGAGTGGG + Intergenic
1077230711 11:1457133-1457155 CCATGCCCACCCACAGGTCTCGG + Intronic
1077912717 11:6587074-6587096 CCAGTACCACTGACAGGAGTGGG + Intronic
1079267758 11:18951139-18951161 CCATGACCAAATACATGAGGTGG + Intergenic
1080752783 11:35166231-35166253 CCATGGCAACACACAGGGGTGGG + Intronic
1088795609 11:113264649-113264671 CCAGGACCACCCACAGGAGAGGG + Intronic
1089200003 11:116718903-116718925 CCATGAACACACAGTGGAGAGGG - Intergenic
1089270279 11:117297117-117297139 CCACGACCACAGACAGGACCTGG + Intronic
1091794201 12:3288010-3288032 CCATCACAACACACAAGAATGGG - Intergenic
1096800935 12:54110000-54110022 CCGTGGCCACGAACAGGAGTAGG - Intergenic
1096820337 12:54228899-54228921 GCATGCCCACACACACCAGTTGG + Intergenic
1097654635 12:62344464-62344486 CCATGAAAACAGCCAGGAGTGGG - Intronic
1097909007 12:64949204-64949226 CCCTGGCCACACACATGGGTAGG - Intergenic
1099838535 12:87937553-87937575 CCATGACAGCAGACAGGAGGGGG + Intergenic
1100594511 12:96060510-96060532 CCCTGACCCCTCACAGGAGGGGG + Intergenic
1104038719 12:125115732-125115754 CCATGACCTCACACAGGTGCAGG + Intronic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1106467442 13:30025435-30025457 CCTTGACCACACCCAGGGTTAGG - Intergenic
1106670918 13:31904028-31904050 CCATGGCCAGACACTGGAGTGGG - Intergenic
1108148365 13:47503587-47503609 ACATGCCCACAGTCAGGAGTTGG + Intergenic
1108490416 13:50975884-50975906 CAATGAAGACTCACAGGAGTTGG - Intergenic
1109426234 13:62168456-62168478 CCAGTCCCACAAACAGGAGTGGG + Intergenic
1111901009 13:94199818-94199840 CCTTGACCACACACAGAAACTGG + Intronic
1112311142 13:98318448-98318470 CCGTGGCCACACACAGGGTTAGG + Intronic
1113185158 13:107679541-107679563 CCATGTCCACTCAGAGGAATTGG - Intronic
1113880667 13:113623760-113623782 CCTTGGCCACGCACAGGAGAGGG + Intronic
1115389265 14:32836119-32836141 CCATTGCAACACACAGGAGTTGG + Exonic
1116714116 14:48406754-48406776 CCATGAAAACAGCCAGGAGTGGG - Intergenic
1117833643 14:59779444-59779466 CCATGACCACACACAGGTAATGG + Intronic
1119172874 14:72547813-72547835 CCATGGCCACATACGGGAATGGG + Intronic
1120405722 14:84091326-84091348 CCAGTCCCACAAACAGGAGTGGG + Intergenic
1121334553 14:93069423-93069445 CCAGGGCCACACACAGCAGCTGG - Intronic
1121457625 14:94048783-94048805 CCCTGAGCAGATACAGGAGTGGG + Exonic
1122715742 14:103696001-103696023 GAACGACCACACACAGGAGGAGG - Intergenic
1122725259 14:103746359-103746381 CCAGGACCACTCACCGGATTTGG + Exonic
1122842412 14:104472892-104472914 CCCTGAACACACACAGGACAGGG + Intergenic
1123082736 14:105703511-105703533 CCAGGGCCAAAAACAGGAGTAGG + Intergenic
1123143803 14:106108659-106108681 GCAGGACCACAGACAAGAGTGGG - Intergenic
1123700053 15:22907635-22907657 CAATGACCACGCACTGGAGAAGG + Intronic
1128583554 15:68826896-68826918 ACATGAACACAGACATGAGTTGG - Intronic
1128738244 15:70065808-70065830 CCAGGTCCACACCAAGGAGTAGG + Intronic
1128887924 15:71305389-71305411 CCAAGATCACCCCCAGGAGTTGG + Intronic
1129340437 15:74882352-74882374 CCAAGCACAGACACAGGAGTGGG + Intergenic
1131647617 15:94362120-94362142 CCATGAACAAACACTGGAGTCGG - Intronic
1134362154 16:13541649-13541671 CTATGAACACACTCAGGGGTGGG + Intergenic
1135918991 16:26631515-26631537 CCATGAAAGCAGACAGGAGTAGG - Intergenic
1140757153 16:78077988-78078010 CCATGGCTACACACAGTATTTGG + Intergenic
1141811477 16:86379039-86379061 CCAGGGGCACACACAGGATTTGG + Intergenic
1142254080 16:89005701-89005723 CCTTGCCCACACATAGGAGCAGG + Intergenic
1146284742 17:31566841-31566863 CCATCACCAGACACAGAAGGAGG - Intergenic
1146604154 17:34243943-34243965 CGATGGCCACACTGAGGAGTTGG + Intergenic
1146634877 17:34496502-34496524 CCATGACCACAGACAGCACTGGG + Intergenic
1146894633 17:36532702-36532724 CAAGGACCACACACAGGTGAGGG + Intronic
1146972258 17:37082752-37082774 CCCGGGCCACCCACAGGAGTGGG - Intergenic
1147545845 17:41401095-41401117 CCATGACCTCACACAGGCGAGGG + Intergenic
1148713126 17:49696426-49696448 CCATGACAAAACACAGAAGTGGG + Intergenic
1148779847 17:50115218-50115240 CCAGCTCCTCACACAGGAGTGGG + Intronic
1149088694 17:52751495-52751517 CCAGTCCCACAAACAGGAGTGGG + Intergenic
1151652886 17:75481051-75481073 CCATGCCCACAGACAGGAGAAGG + Intronic
1151653269 17:75483213-75483235 CCAGGAGCACACACAAGAATCGG + Intronic
1151962016 17:77410512-77410534 CCATTTCCCCACACACGAGTGGG - Intronic
1152018961 17:77770589-77770611 CCCTGACCTCAGACAGGAGGAGG - Intergenic
1153103901 18:1505856-1505878 CCATGACCAGTCACATGAGTGGG - Intergenic
1157273643 18:46294905-46294927 CCATGCTCAAACACCGGAGTGGG - Intergenic
1157411788 18:47469269-47469291 CAATGACCACAGTGAGGAGTGGG + Intergenic
1159606316 18:70478575-70478597 CCATGAAAACAGCCAGGAGTGGG + Intergenic
1160734809 19:657698-657720 CCCTGACAATACGCAGGAGTTGG - Intronic
1161650644 19:5482425-5482447 TCATGCCCACACTCAAGAGTAGG + Intergenic
1162087098 19:8255531-8255553 CCATGTCCCCAGACAGGACTTGG - Intronic
1162343840 19:10108271-10108293 GCATCATCAGACACAGGAGTGGG - Intronic
1163455053 19:17401651-17401673 CCATTACCACAAACAGGAGTTGG + Intergenic
1166535401 19:43570992-43571014 CAGGGGCCACACACAGGAGTGGG - Intronic
1166750955 19:45163827-45163849 CCAGGCACACACACAGGAGTGGG + Intronic
1167035687 19:46993894-46993916 CCCTGACCACACACTGGAGCAGG + Intronic
1167885672 19:52498014-52498036 CCATGTGCACACACAGCAATAGG - Intronic
925350970 2:3200566-3200588 CCAGGAGCACACAGAGGAGGAGG + Intronic
927639569 2:24838194-24838216 CCAAGACCACATCCAGGAGGGGG - Intronic
928249101 2:29659360-29659382 ACATCACTACACCCAGGAGTGGG + Intronic
928877548 2:36057704-36057726 CCATGGCCAAGCTCAGGAGTGGG + Intergenic
930245944 2:48983616-48983638 CCATGATCACCCACAGCAGCAGG + Intronic
930470619 2:51807374-51807396 CCATGACCACACCCAGCAGTCGG + Intergenic
930600437 2:53436593-53436615 CCATTACCACAGACTGGACTTGG + Intergenic
933776462 2:85774057-85774079 CCATGAACAGACCCAGGAGCTGG - Intronic
934229681 2:90168108-90168130 CCATGGCAACACCCAGAAGTTGG + Intergenic
935498899 2:103814168-103814190 CCATGCCCACAGAAAAGAGTGGG + Intergenic
937445263 2:121952235-121952257 GCATCACCACACACAGGAGCAGG + Intergenic
938959130 2:136325137-136325159 CTATGAGCAGATACAGGAGTTGG - Intergenic
938981566 2:136532096-136532118 CCAAGACCAAACCCAGCAGTGGG - Intergenic
940694278 2:156959479-156959501 CCAGTCCCACAGACAGGAGTGGG - Intergenic
947091324 2:226514574-226514596 ACAAGACCACACAAATGAGTAGG + Intergenic
947531307 2:230910308-230910330 CCGAGACCACACCCAGGACTGGG - Exonic
948266963 2:236642133-236642155 CACTGACCACTCACAGGAGCTGG - Intergenic
948817502 2:240520162-240520184 CCATGTCCCCAGACAGGATTTGG - Intronic
948912968 2:241014369-241014391 TCAAGTCCACACCCAGGAGTGGG + Intronic
948982516 2:241501603-241501625 CGATAACCACACAAAGGAGGTGG - Exonic
1170290705 20:14765271-14765293 CTCTGAGGACACACAGGAGTTGG + Intronic
1171852708 20:30319796-30319818 CCGTGGCCACGAACAGGAGTAGG - Intergenic
1172001047 20:31777211-31777233 CTATGACCACACCTAGGAGATGG + Intronic
1172867005 20:38108021-38108043 CCAGGAACACATACAGCAGTGGG + Intronic
1173590683 20:44222455-44222477 CCAAGGCCACACAGAGGGGTGGG - Intergenic
1174200874 20:48805590-48805612 CCAGCACCACACACAGGGCTGGG + Intronic
1176900927 21:14441053-14441075 ACATGTCCACAGACAGGATTTGG - Intergenic
1179707438 21:43190133-43190155 CCATGGCCACGCACAGCTGTGGG - Intergenic
1180031601 21:45212571-45212593 CCCTAACCACACACAGGGCTGGG - Intronic
1181565509 22:23734657-23734679 CCACCACCACACCCAGCAGTGGG - Intergenic
1182890360 22:33813103-33813125 CCTTGACCTCCCAAAGGAGTTGG - Intronic
1183695780 22:39421352-39421374 CCATGTGCACACACATGTGTTGG + Intronic
1183741851 22:39673148-39673170 TGATGAGAACACACAGGAGTGGG + Intronic
1184225637 22:43127671-43127693 CAGGGAGCACACACAGGAGTCGG - Intronic
950175426 3:10870123-10870145 CCATGTTCACAGACAGGAGAAGG + Intronic
951948733 3:28173778-28173800 CCATGATCAGACACAAGATTGGG + Intergenic
953073160 3:39543963-39543985 CCATGACCACACTTGAGAGTGGG - Intergenic
953891334 3:46753712-46753734 GCATCACCAGACACAGGACTAGG + Intronic
953896817 3:46809380-46809402 GCATCACCAGACACAGGACTAGG + Intronic
954201451 3:49025722-49025744 CAAGGACCACACAAAGGAGTTGG + Intronic
956688099 3:71850802-71850824 CAATGACCAAACACAGGAGAGGG - Intergenic
959484971 3:106917436-106917458 CCATGATCAAACATAGGGGTGGG + Intergenic
959812014 3:110630399-110630421 CCATGCCCTCACACAGGGCTGGG - Intergenic
959921621 3:111874515-111874537 CCATGTCCTCATTCAGGAGTGGG + Intronic
959959268 3:112277970-112277992 CCACCAGCAGACACAGGAGTGGG + Intronic
960008293 3:112804789-112804811 AGATGACCACAGACCGGAGTTGG - Intronic
960396562 3:117144643-117144665 CCATGACTAAACACATGATTGGG + Intergenic
961535240 3:127566793-127566815 CCTTGACTACAGACTGGAGTGGG - Intergenic
962173164 3:133124532-133124554 CCTGGAACACACACAGCAGTTGG - Intronic
967735411 3:192946640-192946662 ACATGACCAAACACAGAACTGGG - Intergenic
969112093 4:4850510-4850532 CCATGGCCACACACAGGGATTGG + Intergenic
969224408 4:5785509-5785531 ACATGACCACTCACAGCTGTGGG + Intronic
969485052 4:7467538-7467560 CCAGGCCCACACTCAGGAGCTGG - Intronic
970170372 4:13283430-13283452 CCATGACCACAGTAAGGAGGGGG + Intergenic
972840262 4:42922337-42922359 GGCTGACCACACACAGGTGTAGG - Intronic
977379925 4:96259474-96259496 ACATAATCACACACAGGAATAGG + Intergenic
984047171 4:174815281-174815303 CCATGAAAACAGCCAGGAGTGGG - Intronic
987016686 5:13827422-13827444 CCATGCCTACACACAGCAGGGGG - Intronic
991087495 5:62661326-62661348 CCATGACCACATCCAGTTGTGGG - Intergenic
991418656 5:66418034-66418056 CAATGAGAACTCACAGGAGTAGG + Intergenic
992761946 5:79958183-79958205 CCAGGAGCACACAAAGGAGGTGG + Intergenic
995031185 5:107483295-107483317 CCATGACAACAAAGAGGATTAGG - Intronic
997668966 5:135654881-135654903 CTAGGAATACACACAGGAGTGGG - Intergenic
1003745574 6:8997811-8997833 CCATGACCAGACACTGTACTAGG + Intergenic
1005054789 6:21719440-21719462 ACATGAACGCACACAGGAGAAGG - Intergenic
1005295729 6:24424942-24424964 CCATGACCACACACAGGAGTGGG - Exonic
1007661184 6:43487514-43487536 CCAAGACCACAAGCAGAAGTGGG - Intronic
1008877736 6:56348006-56348028 ACATTACTACATACAGGAGTAGG + Intronic
1016171942 6:141028548-141028570 CCATGACCACTCAACCGAGTTGG + Intergenic
1018511190 6:164526407-164526429 CCATGAAGACACCCAGGAGTGGG + Intergenic
1020094782 7:5362163-5362185 CCATGGCCACAGTCAGGAGGTGG - Intronic
1023805593 7:43870568-43870590 CCATGACCACACTGAGAAGAGGG + Intronic
1024000066 7:45184057-45184079 CCATGACCAGAGGCTGGAGTGGG + Exonic
1026441202 7:70446018-70446040 CTACGACCCCACACAGGAGAAGG + Intronic
1030018024 7:105244171-105244193 CCATGAGAACACAGAGAAGTTGG + Intronic
1032456625 7:132077890-132077912 ACAAGACCACAAACAGGAGCCGG + Intergenic
1032705641 7:134419284-134419306 TCATGCCCACACACAGGGGCTGG + Intergenic
1032998662 7:137478341-137478363 CCATGACCACACAGATGAATGGG + Intronic
1035027642 7:155836359-155836381 CCATGAACACACACAGCGCTTGG + Intergenic
1035399093 7:158553123-158553145 CCATGTACACACACAGGCTTGGG + Intronic
1035811675 8:2496772-2496794 GCATGACCACACACCTGAGATGG - Intergenic
1036204761 8:6796991-6797013 CCATGATCACACAGTGGACTTGG - Intergenic
1037350744 8:17952429-17952451 ACATGACCACACAGAGGTCTTGG - Intronic
1039037475 8:33375408-33375430 CAATGAGCACAGATAGGAGTGGG + Intronic
1040592401 8:48805588-48805610 CCATGAGGACACACTGGAGTGGG + Intergenic
1042777341 8:72448068-72448090 ACAGGACCACATACAGGAGAAGG + Intergenic
1043805929 8:84671712-84671734 CCAAGGCTACACACAGCAGTGGG + Intronic
1044347107 8:91118133-91118155 CCATGAGCACACCCAGTAATGGG - Intronic
1044628588 8:94258002-94258024 CCATGAAAAGACACAGGATTTGG - Intronic
1047927538 8:129696122-129696144 CCAACACCACACACGGGACTTGG + Intergenic
1048440823 8:134457835-134457857 CCAAGGCCACAGGCAGGAGTGGG + Intergenic
1049346647 8:142142760-142142782 ACATGACCCCACCCAGGGGTGGG + Intergenic
1049436954 8:142590844-142590866 CCATGAGCAGGCACAGGAGCTGG + Intergenic
1053790499 9:41683080-41683102 CCGTGGCCACGAACAGGAGTAGG - Intergenic
1054154658 9:61631725-61631747 CCGTGGCCACGAACAGGAGTAGG + Intergenic
1054178844 9:61894779-61894801 CCGTGGCCACGAACAGGAGTAGG - Intergenic
1054658693 9:67686052-67686074 CCGTGGCCACGAACAGGAGTAGG + Intergenic
1056124997 9:83527221-83527243 CCATGAGAGCACACAGGACTAGG - Intronic
1057123950 9:92601663-92601685 CCATGTGCCCACAGAGGAGTGGG + Intronic
1058736905 9:107902152-107902174 CCATGTCCTCACACAGTAGAAGG + Intergenic
1060069407 9:120533264-120533286 CCAAGGCCACACTCAGTAGTTGG + Intronic
1061191497 9:129085203-129085225 CCAGGCCCCCACACAGCAGTGGG + Exonic
1062536653 9:137024003-137024025 CCAGGACCACACAGGGGAGCAGG + Intronic
1187825314 X:23330065-23330087 CCAGGACCACACCAAGTAGTTGG + Intergenic
1199239985 X:145535320-145535342 GCATGACCACACCCAGAGGTAGG + Intergenic