ID: 1005298898

View in Genome Browser
Species Human (GRCh38)
Location 6:24451923-24451945
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005298898_1005298903 -5 Left 1005298898 6:24451923-24451945 CCATCCGGCCCTCCTACGGGCCA No data
Right 1005298903 6:24451941-24451963 GGCCAGCCAGTCATTCCGAGAGG No data
1005298898_1005298907 16 Left 1005298898 6:24451923-24451945 CCATCCGGCCCTCCTACGGGCCA No data
Right 1005298907 6:24451962-24451984 GGAGCACAGAACTTTAAAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 190
1005298898_1005298908 21 Left 1005298898 6:24451923-24451945 CCATCCGGCCCTCCTACGGGCCA No data
Right 1005298908 6:24451967-24451989 ACAGAACTTTAAAGCAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005298898 Original CRISPR TGGCCCGTAGGAGGGCCGGA TGG (reversed) Intronic