ID: 1005298899

View in Genome Browser
Species Human (GRCh38)
Location 6:24451927-24451949
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005298899_1005298903 -9 Left 1005298899 6:24451927-24451949 CCGGCCCTCCTACGGGCCAGCCA 0: 1
1: 0
2: 3
3: 18
4: 217
Right 1005298903 6:24451941-24451963 GGCCAGCCAGTCATTCCGAGAGG No data
1005298899_1005298908 17 Left 1005298899 6:24451927-24451949 CCGGCCCTCCTACGGGCCAGCCA 0: 1
1: 0
2: 3
3: 18
4: 217
Right 1005298908 6:24451967-24451989 ACAGAACTTTAAAGCAGGCCAGG No data
1005298899_1005298907 12 Left 1005298899 6:24451927-24451949 CCGGCCCTCCTACGGGCCAGCCA 0: 1
1: 0
2: 3
3: 18
4: 217
Right 1005298907 6:24451962-24451984 GGAGCACAGAACTTTAAAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005298899 Original CRISPR TGGCTGGCCCGTAGGAGGGC CGG (reversed) Intronic