ID: 1005298899 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:24451927-24451949 |
Sequence | TGGCTGGCCCGTAGGAGGGC CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 239 | |||
Summary | {0: 1, 1: 0, 2: 3, 3: 18, 4: 217} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1005298899_1005298903 | -9 | Left | 1005298899 | 6:24451927-24451949 | CCGGCCCTCCTACGGGCCAGCCA | 0: 1 1: 0 2: 3 3: 18 4: 217 |
||
Right | 1005298903 | 6:24451941-24451963 | GGCCAGCCAGTCATTCCGAGAGG | No data | ||||
1005298899_1005298908 | 17 | Left | 1005298899 | 6:24451927-24451949 | CCGGCCCTCCTACGGGCCAGCCA | 0: 1 1: 0 2: 3 3: 18 4: 217 |
||
Right | 1005298908 | 6:24451967-24451989 | ACAGAACTTTAAAGCAGGCCAGG | No data | ||||
1005298899_1005298907 | 12 | Left | 1005298899 | 6:24451927-24451949 | CCGGCCCTCCTACGGGCCAGCCA | 0: 1 1: 0 2: 3 3: 18 4: 217 |
||
Right | 1005298907 | 6:24451962-24451984 | GGAGCACAGAACTTTAAAGCAGG | 0: 1 1: 0 2: 1 3: 18 4: 190 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1005298899 | Original CRISPR | TGGCTGGCCCGTAGGAGGGC CGG (reversed) | Intronic | ||