ID: 1005298903

View in Genome Browser
Species Human (GRCh38)
Location 6:24451941-24451963
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005298899_1005298903 -9 Left 1005298899 6:24451927-24451949 CCGGCCCTCCTACGGGCCAGCCA 0: 1
1: 0
2: 3
3: 18
4: 217
Right 1005298903 6:24451941-24451963 GGCCAGCCAGTCATTCCGAGAGG No data
1005298898_1005298903 -5 Left 1005298898 6:24451923-24451945 CCATCCGGCCCTCCTACGGGCCA No data
Right 1005298903 6:24451941-24451963 GGCCAGCCAGTCATTCCGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type