ID: 1005303625

View in Genome Browser
Species Human (GRCh38)
Location 6:24494140-24494162
Sequence GCCACTAGTAAGATTAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005303625_1005303628 28 Left 1005303625 6:24494140-24494162 CCAACTTTAATCTTACTAGTGGC 0: 1
1: 0
2: 0
3: 8
4: 134
Right 1005303628 6:24494191-24494213 ACGCTATATTGAATTTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005303625 Original CRISPR GCCACTAGTAAGATTAAAGT TGG (reversed) Intronic
905096366 1:35474677-35474699 GCTACTAGGAAGACTAAGGTGGG + Intronic
905178280 1:36151497-36151519 GCTACTAGGAAGGTTAAGGTGGG + Intronic
909310760 1:74145310-74145332 GCCAATAGTAACAGTAAACTAGG + Intronic
912880455 1:113407134-113407156 GCCACTGGAAAGTATAAAGTTGG + Intronic
916462202 1:165037136-165037158 GCCATTTATAAGATTAAACTTGG - Intergenic
917775106 1:178325376-178325398 GGCACTACTCTGATTAAAGTGGG - Intronic
918699310 1:187587708-187587730 GACACTAGTCAGATTAAATTAGG + Intergenic
919388483 1:196952162-196952184 GCCACTGGTAAGTCTGAAGTAGG + Intronic
919855385 1:201702989-201703011 GACACTAGTAAGATTAGTATTGG - Intronic
921686369 1:218093605-218093627 CCAACTGGTAGGATTAAAGTAGG - Intergenic
924136057 1:240968098-240968120 GCCAAAAGTAAGAATAAAGATGG + Intronic
1063927327 10:10993350-10993372 GCTACTAGAAAGAGTAAATTGGG + Intergenic
1064094386 10:12412306-12412328 GCGACTAGAAAGAGAAAAGTGGG + Intronic
1064465699 10:15578459-15578481 GCTGCTATTAAGATTAATGTAGG + Intronic
1065914073 10:30337629-30337651 GCCACTAGCAAAATGAAAGTTGG + Intronic
1067904308 10:50274835-50274857 GCTACTAGGAAGGTTGAAGTGGG + Intergenic
1077990312 11:7403438-7403460 GCTACTCGTAAGGTTAAGGTGGG + Intronic
1080303591 11:30812911-30812933 GACACTTGTAAATTTAAAGTAGG - Intergenic
1080498250 11:32843140-32843162 GCCAGAAGAAAGTTTAAAGTAGG + Intronic
1081506301 11:43720732-43720754 GCACCTAGTAAGTTTAAACTTGG + Intronic
1088272677 11:108050959-108050981 TCCACTTGTAAGAATAAAATGGG + Intronic
1090012529 11:123058028-123058050 GCCACTACCAACATTAAAATAGG + Intronic
1091967547 12:4757555-4757577 GCCAGTAGGAAGATAAAAGGGGG + Intronic
1094080838 12:26533620-26533642 GCCACTAGTAATATTGAATTAGG - Intronic
1094582331 12:31744881-31744903 GCCACTAGGATGGTAAAAGTAGG + Intergenic
1097217176 12:57423310-57423332 GCTACTTGTAAGACTAAAGTGGG + Intronic
1097862772 12:64534549-64534571 GCCACTGGTGAGAGTAAAGTGGG - Intergenic
1101332204 12:103766215-103766237 GCCACCAGAAAGATTCAACTAGG + Intronic
1101528224 12:105550958-105550980 GCCACTTGAAGGTTTAAAGTAGG - Intergenic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1102043660 12:109816468-109816490 GCCACTTCTGGGATTAAAGTGGG + Intronic
1106788649 13:33131828-33131850 GCCACTTATAAGATTGAAGCGGG + Intronic
1111019496 13:82428765-82428787 GTCACTATTAAAATTACAGTTGG + Intergenic
1111997058 13:95175662-95175684 GACACCAGTCAGATTAGAGTAGG - Intronic
1114810528 14:25893622-25893644 GCCAATAGTAAGAATGAAGATGG + Intergenic
1117211803 14:53508719-53508741 GCCACATGGGAGATTAAAGTGGG - Intergenic
1121662122 14:95642899-95642921 GCCACCAGGAAGGTGAAAGTGGG + Intergenic
1122494455 14:102142563-102142585 GCCACTAGGAAGGCTGAAGTGGG - Intronic
1123154987 14:106216136-106216158 GCCTCTAATAACATTAAAGCAGG + Intergenic
1123401644 15:19993277-19993299 ACCTCTAATAAGATTAAAGAGGG + Intergenic
1124851617 15:33344771-33344793 GCCACTACAAAGCTCAAAGTAGG + Intronic
1127921855 15:63500946-63500968 GCCACTAGGAAAATTAAACCAGG + Intergenic
1138002209 16:53293502-53293524 GCCACTCGGGAGACTAAAGTGGG + Intronic
1139626500 16:68193555-68193577 GCTACTAGGAAGACTGAAGTGGG + Intronic
1141768128 16:86072094-86072116 GCCACTGCTATGATTAAAGCTGG + Intergenic
1146209074 17:30927914-30927936 GCTACTAGGAAGACTGAAGTGGG + Intronic
1147607530 17:41782662-41782684 GCCACTGGGGAGATTTAAGTGGG + Intronic
1149022941 17:51991278-51991300 GCCATTAGAAAGTTTAAAATAGG - Intronic
1150059535 17:62053922-62053944 GCCACTACAAAGATTAATGTTGG + Intronic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1155110954 18:22713944-22713966 ACCAATAGTAAGCTAAAAGTTGG + Intergenic
928846695 2:35682684-35682706 GCCATTAGTAAAGTTAAAATAGG - Intergenic
933860740 2:86464733-86464755 TTCACTAGAAAGTTTAAAGTAGG + Intronic
939107318 2:137964116-137964138 GCCACAAGTAAGTTCCAAGTGGG - Intronic
939608503 2:144281657-144281679 GACACTAGTCAGATTAGATTAGG - Intronic
940089376 2:149898690-149898712 GACTCTAGTCAGATTGAAGTAGG - Intergenic
940421866 2:153488477-153488499 GTGACTATTAAGGTTAAAGTGGG - Intergenic
942092818 2:172510386-172510408 CCCACTAGTAAGACTTAAGTTGG - Intergenic
943180899 2:184540120-184540142 GCCACTTGGAAGTTTGAAGTGGG + Intergenic
945426209 2:209706792-209706814 GCCAATAGTCATATTTAAGTGGG - Intronic
947600811 2:231448840-231448862 GCTACTAGGGAGACTAAAGTGGG - Intergenic
1171181637 20:23095080-23095102 GCCACTGGTAAAATAAAAGCAGG - Intergenic
1177613148 21:23480210-23480232 CCCACTAATATGATTAAAGGAGG + Intergenic
1183193933 22:36340358-36340380 GGCTCTATTAAGAGTAAAGTTGG + Intronic
1183889823 22:40917897-40917919 GCTACTAGAGAGACTAAAGTGGG + Intronic
1184941850 22:47773844-47773866 GACACGAGTCAGATTAGAGTAGG - Intergenic
1184978364 22:48079125-48079147 GCCACTGGGACGATTCAAGTGGG + Intergenic
949768773 3:7555245-7555267 GTCACTAGTAATAATAAGGTGGG + Intronic
949869070 3:8571452-8571474 GCCACTAGGAAGAAGGAAGTGGG - Intergenic
951649770 3:24938139-24938161 GCCAATGGTAAGATGAAAGAAGG + Intergenic
952370427 3:32717752-32717774 GCCACTAGGGAGGCTAAAGTGGG + Intronic
952579216 3:34811274-34811296 GATACTAGTCAGATTAAATTAGG - Intergenic
953800019 3:46015742-46015764 CCCAATAGTAAGGTTAAATTGGG - Intergenic
954853316 3:53621404-53621426 GCCAATAGTAAGATTAGGGCTGG + Intronic
955566807 3:60256095-60256117 GCCACTGGTAAGATCAATGGAGG - Intronic
956800716 3:72755686-72755708 ACCACTAGTACAATTAGAGTTGG + Intronic
961814250 3:129540569-129540591 GCCACTTGGAAGACTGAAGTAGG + Intergenic
964431261 3:156608640-156608662 GACACCAGTAAGATTGAATTTGG - Intergenic
965635269 3:170774219-170774241 GTCACAAGAAAGATTATAGTGGG - Intronic
971303243 4:25458958-25458980 GCTACTTGTAAGACTGAAGTGGG - Intergenic
971649870 4:29257757-29257779 GCTACTAGGAAGGTTGAAGTGGG - Intergenic
973605857 4:52587029-52587051 GCCTCTAGCAAAATTAAAGCAGG + Intergenic
975524268 4:75331677-75331699 GCCACTAGGAAGTTTGAACTGGG + Intergenic
975764387 4:77651842-77651864 GGCAGTAGAAAGATTCAAGTTGG + Intergenic
976708598 4:88044291-88044313 CTCACCAGGAAGATTAAAGTGGG - Intronic
978601399 4:110431929-110431951 GCCACTAGGAAGCTTGAACTGGG - Intronic
980198688 4:129625959-129625981 TCCATTAGAAAGATTAAAATTGG - Intergenic
980313330 4:131163640-131163662 GCCATTAGTAAAATTGAATTGGG - Intergenic
981008363 4:139898958-139898980 GTCACTAGTTACATTAAAGTTGG - Intronic
982542368 4:156689964-156689986 CACACTAGTAAGATTAAATGTGG + Intergenic
982558861 4:156903925-156903947 CACACTAGTGAGATTAAAATTGG - Intronic
989201393 5:38767958-38767980 TCCACTTGTAAGATGAAATTAGG - Intergenic
990058570 5:51617796-51617818 GCCATTAGGAAGCTTCAAGTAGG - Intergenic
991236725 5:64407352-64407374 GCCACTAGGAAGTTCAAACTGGG + Intergenic
993410461 5:87567289-87567311 GCCACTGGGAAGTTCAAAGTAGG - Intergenic
993586189 5:89731922-89731944 GTAACTAGTAATATTAGAGTTGG - Intergenic
994066529 5:95549413-95549435 GCCATTAGTAATTTTTAAGTAGG + Intronic
995210194 5:109529264-109529286 ACCACTAGAAAAATCAAAGTAGG - Intergenic
998098020 5:139408402-139408424 GCTACTAGGAAGGTTAAGGTGGG - Intergenic
1004816392 6:19315893-19315915 GACACCAGTCAGATTAAATTAGG - Intergenic
1005303625 6:24494140-24494162 GCCACTAGTAAGATTAAAGTTGG - Intronic
1005790054 6:29290787-29290809 GCCACCAGAAAGATTACAGAGGG - Intergenic
1008717971 6:54312168-54312190 GCTACTTGGAAGTTTAAAGTGGG - Intronic
1012608132 6:101183385-101183407 GCCAGTAGTAAGCCTAAAGGGGG - Intergenic
1013452518 6:110298794-110298816 GTGATTAGTAAGATTAAAATCGG + Intronic
1013998983 6:116343138-116343160 GCCACTAGGAAGCTCAAACTGGG + Intronic
1015233695 6:130946274-130946296 GCCAAAAATAACATTAAAGTTGG + Intronic
1020024050 7:4886073-4886095 GACACTAGTCAGATTAGACTAGG + Intergenic
1020358261 7:7301074-7301096 GCCACCAGGAAGTTCAAAGTGGG - Intergenic
1020442336 7:8231504-8231526 GCTATTATCAAGATTAAAGTAGG - Intronic
1021347656 7:19548001-19548023 GCCACTGGGAAGTTTAAACTGGG - Intergenic
1021378866 7:19941816-19941838 GCCACTAGTAAACTTGAAGGTGG - Intergenic
1021425412 7:20494646-20494668 GACACTAGTCAGATTGAATTAGG - Intergenic
1022214376 7:28243688-28243710 GACACTAGTCAGATTAAAACAGG - Intergenic
1023021565 7:36016203-36016225 GCCACTTGGGAGATTGAAGTGGG + Intergenic
1023194484 7:37619284-37619306 GGCACTAGTACAATTAAATTTGG + Intergenic
1023916562 7:44594134-44594156 GACACAATAAAGATTAAAGTAGG + Intergenic
1024769947 7:52710451-52710473 GACACTAATAAAATGAAAGTGGG - Intergenic
1030654696 7:112154081-112154103 GCTACTAGGGAGACTAAAGTGGG - Intronic
1031626428 7:123997692-123997714 GGCAGTAGTGAGATTAATGTAGG + Intergenic
1031990623 7:128196577-128196599 GACACCAGTCAGATTAAATTAGG + Intergenic
1033221902 7:139532490-139532512 GCAACTAGTCAGATTCAAGCAGG + Intronic
1034115483 7:148579980-148580002 GCCACTAGTAAGCCTGAAATTGG + Intergenic
1037077953 8:14745306-14745328 GTCACTACTAAGATTTCAGTGGG + Intronic
1037943155 8:22969861-22969883 GCTACTTGGGAGATTAAAGTGGG - Intronic
1038567111 8:28628913-28628935 GCAACCAGGAAGATTAAAATGGG + Intronic
1046770858 8:118114698-118114720 GCTACTTTTAAGATTACAGTTGG - Intergenic
1047854899 8:128898914-128898936 GCCTCTAGTAAGATTTCTGTAGG + Intergenic
1050214312 9:3305391-3305413 GCTAGTAGTAAGGTTAAAATAGG + Intronic
1052096569 9:24391243-24391265 GCCACTAGGAAGTTTGAACTGGG - Intergenic
1052723906 9:32206490-32206512 GCTACTAGTAGGAATAATGTGGG - Intergenic
1052844050 9:33319128-33319150 GTAACTAGTAAGCGTAAAGTTGG + Intronic
1054874499 9:70081179-70081201 GCCAGGAGTAAGATTTAATTTGG + Intronic
1055966385 9:81869129-81869151 GCCAAAACTAAAATTAAAGTTGG - Intergenic
1056744334 9:89287056-89287078 GTCACTAGAAAGACTAAAGAGGG + Intergenic
1056997119 9:91473361-91473383 GGCACTAGGAAGCTCAAAGTGGG - Intergenic
1058032606 9:100216181-100216203 GCCACTTGGAAGACTACAGTTGG - Intronic
1058072856 9:100619376-100619398 GCCACTAGGAAGTTCAAACTGGG - Intergenic
1058186010 9:101855849-101855871 GCCAGAAGAAAGATGAAAGTGGG + Intergenic
1194355799 X:92882349-92882371 GCCACTGGGAAGATCAAACTGGG + Intergenic
1194645609 X:96454807-96454829 GACACTAGTAATATTAGATTAGG + Intergenic
1198968894 X:142257504-142257526 GCCACTAGGAAGGCTGAAGTTGG + Intergenic
1200664146 Y:5999330-5999352 GCCACTGGGAAGATCAAACTGGG + Intergenic