ID: 1005303987

View in Genome Browser
Species Human (GRCh38)
Location 6:24496090-24496112
Sequence CTTCAGAGGGAGAGCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 321}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005303987 Original CRISPR CTTCAGAGGGAGAGCTTTGA AGG (reversed) Intronic
900893531 1:5466764-5466786 ATTCAGAGGTGGAGCTTTCAGGG + Intergenic
900919870 1:5663227-5663249 CTTCCGAGGCAGAGCTTGGTAGG + Intergenic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902793579 1:18785469-18785491 CTTCAGAGGCAGAGCTGGGATGG + Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903558534 1:24210819-24210841 CTTCAGAGGCAGAGCGCCGATGG + Intergenic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905463590 1:38136811-38136833 CTTCAGAGGGAAAGCTGGGGAGG + Intergenic
905477860 1:38241605-38241627 CTGCAGAGGGAGAGCTCAGCCGG + Intergenic
906368237 1:45229209-45229231 CTTCAGAGTGGTAGCTTTAAAGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907586261 1:55620650-55620672 CTGCAGGGGCAGAGCCTTGATGG + Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908660947 1:66434528-66434550 CTTCAGAGGGACAGCAGTGCAGG + Intergenic
909105578 1:71402634-71402656 GTTCAGAGGGAGTACATTGACGG + Exonic
909445370 1:75743166-75743188 CTTGAGAGAGAGAGCCTTAATGG - Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910116792 1:83740130-83740152 CGTCAGAAGGAGAGTTTTGAAGG - Intergenic
911101537 1:94099575-94099597 CTTCAGAGAGGAAGCCTTGATGG - Intronic
912396379 1:109347678-109347700 CTTGACAGGCAGAGCTGTGAAGG - Intronic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
913208461 1:116563633-116563655 CTTCAGAGGGTAAGCCTTGGTGG - Intronic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
917895544 1:179483985-179484007 CTTTAGAGGGAAGGCATTGAGGG + Intronic
918223626 1:182458406-182458428 CTTCAGAGGTAGAGAGTTTAGGG + Intronic
920195933 1:204227264-204227286 AGTGAGAGTGAGAGCTTTGAAGG - Intronic
921919323 1:220648566-220648588 ATTCAGAGGCACAGCTTGGAAGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923965971 1:239139673-239139695 ATTCAGAGAGTGAGCATTGAGGG - Intergenic
1062771905 10:108033-108055 TTTGAGAGGGAAAGCTTGGAAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063759089 10:9051846-9051868 ATACAGAGGGAGAGCATTCAAGG - Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065862182 10:29881270-29881292 CCTCAGAGCCAGAACTTTGAGGG - Intergenic
1065962873 10:30748439-30748461 TTTCAGAGGAAGACCTTGGAAGG + Intergenic
1066281657 10:33923731-33923753 CTTCAGAGGGACAGCTTGACGGG + Intergenic
1068314069 10:55319535-55319557 CTTCAGAGGGAAGACTTTGTGGG + Intronic
1068593956 10:58882525-58882547 TTTCATAGGGAAAGCTTTCATGG + Intergenic
1068904435 10:62307366-62307388 CTTCAGAGGGACAGCTTGACGGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070903032 10:80047500-80047522 CTTCACAGTCAGAGCTTTGGTGG + Intergenic
1071417827 10:85457698-85457720 CTACAGAGGAAGAGCTATTATGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072769371 10:98124810-98124832 CTGCAGAGGCAGAGCCTTCATGG - Intergenic
1074150050 10:110751039-110751061 CAGCAGAGAGAGGGCTTTGAAGG + Intronic
1074466484 10:113687154-113687176 CTTCTGAAGGACAGCTTTGCTGG + Intronic
1074873333 10:117595009-117595031 CCTCAGAGGGAGAGGTTCGGGGG + Intergenic
1076396473 10:130141876-130141898 CTCCTGAGGGAGGGTTTTGAGGG + Intronic
1076890734 10:133281969-133281991 CTTCAGAGCGAGCGCTGTGCAGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1079721929 11:23826077-23826099 CTTCAGGGGCAGAGCTTTCATGG - Intergenic
1079979449 11:27133605-27133627 TTTCTGAAGGACAGCTTTGATGG - Intergenic
1080215707 11:29837648-29837670 CTTCAGAGGTACAGCGTTGGAGG + Intergenic
1081160601 11:39743633-39743655 CTGCAGAGGCAGAGCCTTCATGG + Intergenic
1081325418 11:41738371-41738393 CTGCAGAGGCAGAGCTCTCATGG - Intergenic
1082094719 11:48120174-48120196 CTTGAGACTGAGAGGTTTGAAGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1087292870 11:96339484-96339506 CTTCAGAGGCTGGGCTGTGAAGG + Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088818974 11:113441036-113441058 GTTGACAGAGAGAGCTTTGATGG + Intronic
1089830810 11:121326358-121326380 CTTCAGAGGTAGAGGTGGGAGGG - Intergenic
1090162649 11:124511134-124511156 CTTCAGAGGGAAGGCACTGAGGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091169377 11:133506847-133506869 CTGCACAGGGCCAGCTTTGAAGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093188184 12:16045780-16045802 CTTGAGTGGGAGCTCTTTGAGGG + Intergenic
1093829113 12:23733963-23733985 CTTCATAGAGAGATTTTTGAGGG - Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094556833 12:31509245-31509267 CGACAGAGGAAAAGCTTTGAGGG - Intronic
1097200115 12:57271103-57271125 CTGCATAGGCAGAGCTGTGAAGG - Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1099331701 12:81297024-81297046 CTCCAGAGTGAGAGCTCAGAGGG - Intronic
1099596620 12:84674312-84674334 CTTCAGAGAGAGAAATTTTATGG - Intergenic
1099698002 12:86045098-86045120 CTTCAGAGGGAAGGCATTGAGGG - Intronic
1100945710 12:99781494-99781516 TTTTAAAGGGAGTGCTTTGAAGG - Intronic
1101751780 12:107587982-107588004 CTTTAGAGGGAGGCTTTTGAAGG - Intronic
1105603840 13:21910585-21910607 CTTCTGAGGGAGACATTTGATGG + Intergenic
1106841365 13:33688190-33688212 CTTCAGAGGGAGCTTTTTCAGGG - Intergenic
1108220671 13:48230658-48230680 CTTCTAGGTGAGAGCTTTGAAGG - Intergenic
1110908386 13:80922126-80922148 ATTCAGAAGGACAGCTTTTATGG - Intergenic
1111241647 13:85482404-85482426 CTTCAGGGGCAGAGCCTTCATGG - Intergenic
1111813315 13:93119434-93119456 CTTCAGAGGAAGTGTTTTCATGG + Intergenic
1112634741 13:101202795-101202817 CTTTAGAGTGAGAGCAGTGATGG - Intronic
1113633490 13:111904240-111904262 CTTTAGAGGGAGGGCATGGAGGG + Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114417889 14:22556491-22556513 CTTCTGCGGGAGAGCTTCAAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116016696 14:39416212-39416234 TTTCTGAGGGATAGCTTTGCTGG + Intronic
1116043504 14:39714851-39714873 CTTCAGAGAGAAATATTTGAGGG + Intergenic
1116184559 14:41580970-41580992 ATACAGAGAGAGAGATTTGAAGG - Intergenic
1117804402 14:59475868-59475890 ATTCACAGGGAAAGCTGTGAGGG - Exonic
1119471442 14:74902562-74902584 CTTAAGAGAGAGAGCCTTAATGG + Exonic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1125534658 15:40436302-40436324 CTCCAGAGGGAGAGCGTGGAGGG - Intergenic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126815277 15:52447945-52447967 CTGCAGAGGCAGAGCCTTCATGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128214134 15:65922679-65922701 CTGCAGAGGGAGAGACTAGAGGG + Intronic
1128310631 15:66629974-66629996 CTGCAGAGGGAGAGCTGTGCAGG - Intronic
1129413579 15:75362620-75362642 GGTCAGAGGGACAGCTGTGAGGG - Exonic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1131032907 15:89201367-89201389 ATTCAGTGGGACAGCTTTGCTGG + Exonic
1131512674 15:93057836-93057858 CTTCAGAGGGAGAGATTGGGGGG + Intronic
1132147867 15:99439001-99439023 GCTCAGAGTGAGGGCTTTGAAGG + Intergenic
1133116372 16:3580048-3580070 CTCCAGAGGGAAAGGGTTGAAGG - Intergenic
1133255306 16:4512902-4512924 CTGCAGGGAGAGATCTTTGAGGG - Exonic
1133774831 16:8888128-8888150 ATCCAGAGGGAGAGATTTGATGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137855104 16:51786529-51786551 TTTCAGAAGGAGAGCATTGGTGG + Intergenic
1137992646 16:53175186-53175208 CTTCAGAGGGTGCCCTTTAAAGG - Intronic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1140133467 16:72184282-72184304 CTCCAGATGGAGAGCTGTGCTGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143419828 17:6780054-6780076 CTTCAGCGGGAGACCTTCCAGGG + Exonic
1145216257 17:21054786-21054808 CTTAAGATTGAGAGCCTTGAAGG + Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147020680 17:37530158-37530180 CTTCAGAGGGACAGGTTGGGTGG - Intronic
1147333439 17:39712426-39712448 TTTCTGCCGGAGAGCTTTGATGG + Exonic
1147592196 17:41691139-41691161 CTGCAGAGGGAGAGCTGAGGAGG - Exonic
1149326079 17:55531062-55531084 CTTCAGAAGGATGGCTTGGAAGG - Intergenic
1151565608 17:74896006-74896028 CTAGAGAGGGAGGGATTTGACGG - Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152271427 17:79327147-79327169 CCACAGAGGGAGAGCCTTGTGGG - Intronic
1152810215 17:82378222-82378244 ATGCAGAAGGAGAGCTTTGGGGG + Intergenic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153545979 18:6205185-6205207 TGTCAGAGGCAGAGGTTTGAAGG + Intronic
1155090560 18:22504965-22504987 CAACAGAGGTAGAGCTTTGTTGG - Intergenic
1155603895 18:27581648-27581670 CTTCAGGGAGACAGATTTGAGGG + Intergenic
1158921731 18:62199651-62199673 CCTCAGAAACAGAGCTTTGATGG - Intronic
1159544533 18:69822624-69822646 CTTCAGAGGAAGACCTTTGCAGG + Intronic
1160441549 18:78896540-78896562 CTTCAGAACCAGAGCTGTGATGG - Intergenic
1161084742 19:2329615-2329637 CTTAAGAGTGAGAACTCTGAGGG - Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166798588 19:45442781-45442803 CTTCTGATGGAGGGCTTGGATGG + Intronic
1167718600 19:51161237-51161259 CTTCAGAGGGGAGGCTTTCAGGG + Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926311634 2:11679849-11679871 CTTCAGAAGCAGAGCCTTGCAGG - Intronic
927213410 2:20652268-20652290 GTTCTGAGGGAGACCCTTGAAGG + Intergenic
927918955 2:26956663-26956685 CTTCAGTGGCAGTGCTTTGACGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928394734 2:30934745-30934767 GCTCAGAGGCAGAGCGTTGAGGG - Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930960356 2:57253267-57253289 CTTCAGAGGCAGAGCCCTCATGG + Intergenic
930961461 2:57267038-57267060 CTTCAGTGGGAGAGCTCTCATGG - Intergenic
932378640 2:71261367-71261389 CTTTAGAGGGGGAGGGTTGAAGG + Intergenic
933180948 2:79226948-79226970 GCTCAGATGGAGAGCTCTGAGGG + Intronic
933249690 2:80015435-80015457 CTTCAGGGTGACAGCTTTCATGG - Intronic
934027141 2:88010583-88010605 CTGCAGAGGGTGAGATATGAGGG + Intergenic
934987066 2:98895245-98895267 CAACAGAGGGAGGGCCTTGATGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
936194885 2:110361899-110361921 CTTCACAGTGAGAACCTTGAAGG + Intergenic
936282552 2:111155026-111155048 CTGCATAGGAAGAGCTGTGAGGG - Intronic
937154670 2:119710534-119710556 TGTCAGAGGGAGAGGCTTGAGGG + Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939070876 2:137540554-137540576 CTTCAAAGATAGGGCTTTGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
940716944 2:157237015-157237037 CTTCAGAGGGACAGCTTGCTGGG + Intergenic
940817853 2:158315986-158316008 TCTCAGAGGGAGGGCTGTGAAGG - Intronic
942405121 2:175646181-175646203 CTTCAGAGGGAAAGCATCGAGGG + Intergenic
943197059 2:184766879-184766901 CTTCAGAGGTAGGGTTTTTAAGG + Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945449411 2:209976496-209976518 CTTCACAGTAAGAGCTTTGTTGG + Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
947434998 2:230065841-230065863 CTGGAGAGGGAGAACTTAGAGGG + Intronic
947603252 2:231467677-231467699 CTTCAGTGGAAGAGCCTGGAAGG - Intronic
947740055 2:232480892-232480914 CTTCACAGGGAGAGCAGGGAGGG - Intronic
948721850 2:239905687-239905709 CATCAGAGGGAGAGCTTCCGAGG + Intronic
1168928225 20:1600025-1600047 CTTCAGAGTGAGAGAGTTGCAGG + Intronic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169341388 20:4799185-4799207 CTTCAGAGGGGGAGTTTCTAAGG - Intronic
1169966777 20:11226632-11226654 GTCCAGAGGGAGTTCTTTGAAGG - Intergenic
1170529926 20:17281107-17281129 CCTCAGATGGAGAGTCTTGAAGG - Intronic
1170552145 20:17487293-17487315 ATTCAGAGGGACATCTTTGAGGG - Intergenic
1172106682 20:32521396-32521418 CTTCTTAGGAAGAGCTGTGAAGG + Intronic
1172226701 20:33310103-33310125 CTTCAGTGGGATGGCTTTTAGGG + Intergenic
1173965452 20:47109138-47109160 CTTCAGGGGGAGACCCTGGATGG - Intronic
1175108958 20:56632373-56632395 TGTCAGAGGGAGAGTTTTGCAGG + Intronic
1175480914 20:59310164-59310186 CCTCAGAGGGGGAGCTGTAAAGG + Intronic
1175710819 20:61219338-61219360 TGTCAGAGGGACAGCTTTGTGGG + Intergenic
1179317171 21:40254140-40254162 ATACAGAGTGAGGGCTTTGATGG + Intronic
1179338122 21:40476714-40476736 GGTCATAGGGAAAGCTTTGATGG + Intronic
1179805000 21:43831767-43831789 CTTCAGAGGGAGGGATTCGCAGG + Intergenic
1180854624 22:19038219-19038241 CCTGAGAAGGAGAGCTTGGAAGG - Exonic
1181300340 22:21875512-21875534 ACTCAGAGTGAGAGCTTTGCTGG + Intergenic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181666169 22:24399156-24399178 CTCCAGAGGGAGACGTTTCATGG - Intronic
1182437459 22:30339913-30339935 GTTTAGAAGGAGAGCATTGATGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183662774 22:39231206-39231228 CTGAATAGGGAGAGCTTTGGGGG + Intronic
1184043465 22:41957999-41958021 CTGCAGAGGGATAGCGTGGAGGG - Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184944778 22:47795495-47795517 CTTCACATGGAGAGCCTTGCTGG - Intergenic
949442144 3:4093357-4093379 CTTCAGAGTGAGAGTTTTTGTGG - Intronic
951173481 3:19571654-19571676 GTTCAGAGCCAGAGTTTTGATGG + Intergenic
951258696 3:20481738-20481760 CTTCAGAGGGAAGGCACTGAGGG + Intergenic
951616488 3:24552001-24552023 CTTCATAAGGAGATCTTTGTTGG + Intergenic
952927898 3:38335199-38335221 CTTCAGAGGTAGGGCAGTGATGG + Intergenic
954144309 3:48626763-48626785 GTTTAGAAGGGGAGCTTTGAGGG + Intronic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954544577 3:51421980-51422002 CTTCAGAGTGTGAGCTTTTCAGG + Intronic
956937253 3:74117116-74117138 ATTCAGGGAGAGAGCTGTGATGG - Intergenic
958722230 3:97858126-97858148 TTTCTGAGGGATAGCTTTGCTGG + Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960954577 3:123022931-123022953 CTTCAGAAGGAGAGTATTGGAGG + Intronic
961628953 3:128282307-128282329 GTTCACAGGGAGCCCTTTGAGGG + Intronic
962182411 3:133222161-133222183 TTTCAGAAGGACAGCTTTGCTGG + Intronic
962494681 3:135927066-135927088 ATTCACAGGAACAGCTTTGATGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
963955583 3:151250017-151250039 CATTTAAGGGAGAGCTTTGAGGG - Intronic
964400674 3:156294758-156294780 TTTCATAGGCAGAGCTTTAAAGG + Intronic
964453887 3:156839266-156839288 CTTCAGAGACAAAGCATTGATGG - Intronic
966097625 3:176224451-176224473 CTTCCGAAGCACAGCTTTGATGG - Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967937319 3:194739362-194739384 TTTCAGAGGAAGTGCTTTGAAGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969039481 4:4284180-4284202 CTCAAGATGAAGAGCTTTGAGGG + Intronic
969470522 4:7384992-7385014 CTTTGGAGGGAGAGCCTTCAGGG + Intronic
970099346 4:12503055-12503077 CTTCAGAGGCAGAGCCTTCATGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971957658 4:33442713-33442735 CTGCAGAGGCAGTGGTTTGAAGG + Intergenic
972270231 4:37503340-37503362 CTTCAGAGGGAAGGCACTGAGGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973046604 4:45541591-45541613 CTTCAGGGGCAGAGCCCTGAGGG + Intergenic
973637038 4:52870064-52870086 TTTGAGAGGGAAAGCTTGGAGGG - Intergenic
973752177 4:54032289-54032311 CATCAGAGGGAGACCGTAGAGGG - Intronic
975448586 4:74498521-74498543 TTTCTGAAGGACAGCTTTGATGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
977474605 4:97489765-97489787 CTTCAGAAGGAGACCTTTGAAGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978420311 4:108525782-108525804 CTTCAGAGACAAAGCATTGATGG - Intergenic
978758664 4:112331285-112331307 CTGCAGTGGGAGACCTTTGGTGG + Intronic
979124039 4:116944586-116944608 GTTCAGAGGGATAGATATGAAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
980646123 4:135644301-135644323 CTGCAGGGGCAGAGCTTTCATGG + Intergenic
981433560 4:144691787-144691809 CTTTAGAGTGAGGGCTTTGGAGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
983728476 4:170961868-170961890 CTTCTGAAAGACAGCTTTGATGG - Intergenic
984701052 4:182819117-182819139 GTACAGAGGGAGAGCTGTGGAGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985267655 4:188164977-188164999 CTACACAGGAACAGCTTTGAGGG + Intergenic
986058413 5:4162494-4162516 CCTCAGACAGAGAACTTTGAGGG - Intergenic
988008458 5:25450554-25450576 CTTGAGAGTGAGAGCTAAGAGGG - Intergenic
988621886 5:32831626-32831648 GTTCAGAAGGACAGTTTTGAGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990137607 5:52665728-52665750 CTTCTTAGGGAGAGATGTGAAGG - Intergenic
990881158 5:60540748-60540770 CTACAGAGCGAGAGCTCTGAAGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
993026977 5:82658525-82658547 CTTCTCAGGGAAAGCTTTGTGGG + Intergenic
994093721 5:95830243-95830265 GTTTAAAGGGAGAGCTCTGATGG + Intergenic
996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG + Intergenic
996763445 5:127010158-127010180 CTTCATAGAGAAATCTTTGAAGG + Intronic
1000101009 5:158016224-158016246 CTTTAGAAGCAAAGCTTTGAAGG - Intergenic
1004449952 6:15736191-15736213 CTTAAGAGTTAGGGCTTTGAAGG + Intergenic
1004996478 6:21198700-21198722 CTTCACTGTGAGAGCTTTGAAGG + Intronic
1005303987 6:24496090-24496112 CTTCAGAGGGAGAGCTTTGAAGG - Intronic
1005772002 6:29082815-29082837 CTTCGGAGGGAAGGCATTGAGGG - Intergenic
1007314987 6:40979866-40979888 CTTCAGAGGGAAGGCATTCAGGG - Intergenic
1007419162 6:41708925-41708947 CCTCAGAAGGAGAGCTGGGATGG + Intronic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1009689276 6:67007094-67007116 CTACATAGTGAGAGTTTTGATGG + Intergenic
1011412140 6:87076859-87076881 GTGAAGAGGGAGAGCTTTGTAGG + Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020143171 7:5623421-5623443 CTTCAGAGCCAGGGCCTTGATGG + Intronic
1020438636 7:8193628-8193650 CTACAGAGGGAAGGATTTGAAGG - Intronic
1020706029 7:11545508-11545530 CTTCAGAAGGATGGCATTGAAGG + Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022798137 7:33749115-33749137 CTGCAAAGGGAGAGTTCTGAAGG + Intergenic
1024688450 7:51773658-51773680 CTTCACAGGGAGAGATTTTCAGG + Intergenic
1024999809 7:55306348-55306370 CTTCAGGAGGAAAGGTTTGAGGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1027594057 7:80150950-80150972 CTCCAGAATGACAGCTTTGATGG + Intronic
1028283180 7:88959568-88959590 TATCAGAGGAAGAGCTTAGAAGG - Intronic
1030623792 7:111821231-111821253 CTCCAGATGGCAAGCTTTGATGG - Intronic
1030761695 7:113359620-113359642 CTTGAGAGGGGCAGCTTTGCTGG + Intergenic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033618809 7:143043244-143043266 CTTCATAGCAAGAGCTTTAAGGG - Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1036446345 8:8824648-8824670 CTTCAGCTGGTGAGATTTGAGGG - Intronic
1037751363 8:21684508-21684530 CTTCAGAGGGAGAGGTCAGAGGG - Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039339163 8:36627986-36628008 ATTCAGAGGGAGAGTGCTGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041795913 8:61748186-61748208 TTTCAGAGGGAGAGCTCTAGGGG - Intergenic
1042939584 8:74093771-74093793 CTGCAGAGGGTGAAATTTGAAGG - Intergenic
1042976868 8:74478987-74479009 CTTCACAGGGAAAGCATTGAGGG - Intronic
1043512207 8:80960703-80960725 CTGCTGAGGAAGAGCTTTGGGGG + Intergenic
1043701366 8:83292012-83292034 CTTCAGAGGGAAAGCTTGACAGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045375861 8:101573694-101573716 CTTCTGACGGAGAGATTTGGTGG - Exonic
1045496499 8:102713923-102713945 CTTCTGAGAGAGAGCTTCTAGGG + Intergenic
1045744320 8:105399398-105399420 TTTCGGAGGTAGAGCTTTTAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046686855 8:117237336-117237358 CTTCAGAGGCAAAACTTTAATGG + Intergenic
1046839524 8:118841479-118841501 CTGCAGGGGCAGAGCTTTCATGG + Intergenic
1047282023 8:123454062-123454084 CTTCAGGTGGACAGCTGTGAAGG - Intronic
1048097165 8:131309410-131309432 CTTGAGAGGGAGAGCCTTTTGGG - Intergenic
1048438689 8:134443054-134443076 CTTCAGAGACAGAGCATTGATGG - Intergenic
1050279431 9:4034856-4034878 CTTCAGAGGGTGAGTGGTGAGGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050938191 9:11424952-11424974 CTTCAGAGGCAGAGCCCTCATGG - Intergenic
1056160441 9:83885908-83885930 CTTCAGTGAGAGAGCATTAAGGG + Intronic
1056311192 9:85342541-85342563 CTTCAGAAAGAGAGCTTTCATGG + Intergenic
1056446403 9:86670320-86670342 CTGCAGGGGGAGAGCTGAGAAGG - Intergenic
1056934194 9:90903355-90903377 CTGCAGAGGGACAGGTTTGAGGG - Intergenic
1058634071 9:107019440-107019462 CTTGAGAGAGAGAGGGTTGAGGG + Intergenic
1059868474 9:118544863-118544885 CTTCAGAAGGAAGGCATTGAAGG + Intergenic
1060396340 9:123319441-123319463 CCTCGGAGGGAGAGCATAGAGGG - Intergenic
1060520068 9:124289319-124289341 CTGCAGAGGCAGAGCTTGGATGG - Intronic
1203548804 Un_KI270743v1:151842-151864 CTTCAGCGGGAGTCCGTTGAAGG - Intergenic
1186952790 X:14645948-14645970 TTTCAGAGGAAGTGCTTTAATGG - Intronic
1187204564 X:17169907-17169929 GGACAGAGGGAGAGCTTGGAGGG - Intergenic
1187393014 X:18897883-18897905 CTGCAGTGGGAGAGCTTTGAGGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189030880 X:37448871-37448893 CTTCAGAGGCTGAGGTGTGAGGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190540374 X:51471339-51471361 TTACAGAGGGAAAGCCTTGAAGG - Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191141512 X:57120779-57120801 CTTAAGAGGGAGAGCACTGCGGG - Intronic
1191143157 X:57136747-57136769 CTTAAGAGGGAGAGCACTGCGGG - Exonic
1191161240 X:57331423-57331445 CTTCAGAGAGAAGGCATTGAGGG - Intronic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192800825 X:74463111-74463133 CTGCAGAGGGAGAGGATGGATGG + Intronic
1195211079 X:102652445-102652467 CTTGAAAGGGTGAGCTTTGGAGG + Intronic
1199060547 X:143350845-143350867 CTTTAGAGGTAGAGCTCTCATGG - Intergenic
1199373786 X:147083537-147083559 CTTCAGAGGTAGAGCCCTCATGG + Intergenic
1200884310 Y:8253084-8253106 TCTCAGAGGGAGAGCTGGGAAGG + Intergenic
1201861176 Y:18598673-18598695 CTTGAGAGGCAGAGGTTTCAGGG + Intergenic
1201872147 Y:18721707-18721729 CTTGAGAGGCAGAGGTTTCAGGG - Intergenic