ID: 1005310041

View in Genome Browser
Species Human (GRCh38)
Location 6:24550307-24550329
Sequence CCTACCTTGTGCACAGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005310041 Original CRISPR CCTACCTTGTGCACAGGCAC CGG (reversed) Intronic
901692459 1:10982333-10982355 CCTTCCTTGGGCACAGAGACAGG - Intergenic
901899369 1:12345438-12345460 CCGACTTTGTCCACAGACACTGG - Exonic
904892695 1:33791356-33791378 CCTACCATGCTCCCAGGCACTGG - Intronic
905693484 1:39958978-39959000 GCTACCCTGAGCACGGGCACTGG + Intronic
906533578 1:46538723-46538745 CCTCCCTCCTGCTCAGGCACTGG - Intergenic
906731153 1:48082326-48082348 CCTACCTTATGCAGAGGGAACGG + Intergenic
907310318 1:53535377-53535399 CCTACCGTGAGTCCAGGCACTGG + Intronic
907323097 1:53618045-53618067 CCCACCTTGTGCCCCAGCACAGG - Intronic
908677550 1:66622334-66622356 CCTACCTATTGCCCAGGCCCTGG - Intronic
910073479 1:83247575-83247597 TCTGCCTTGTGCACAGTCAGAGG + Intergenic
910666491 1:89730659-89730681 CCTACCCTGTGCAGAGGCAATGG - Intronic
915683258 1:157603310-157603332 CCTAACTTTTGCAGAGGCCCCGG - Intergenic
915806551 1:158859409-158859431 CCTGGCTTGTGCACTGGCTCAGG - Intergenic
915988469 1:160490014-160490036 CCTACATGGTTCACAGGCATAGG - Intronic
916513878 1:165497601-165497623 CCCACAGTGTGCCCAGGCACCGG - Intergenic
917986568 1:180326255-180326277 CCTCCCTTTTCCACAGGCAGAGG + Intronic
920262122 1:204695730-204695752 CCTACTATGTGCACAGGCCTCGG - Intergenic
921193520 1:212730513-212730535 CCAATCTTTTACACAGGCACAGG + Intronic
921593480 1:217029955-217029977 CCTCCCTTTAGCACAGGGACAGG + Intronic
922571995 1:226639837-226639859 CCTGCCCTGTGCCCAGACACAGG + Intronic
922798117 1:228351542-228351564 CCTACCTTGAGGACAGGGACCGG - Intronic
1066199438 10:33130947-33130969 CCTACTCTGTGAAAAGGCACCGG - Intergenic
1070477591 10:76845469-76845491 CCTCCCTTTTCCACAGGCAGAGG - Intergenic
1070864638 10:79700524-79700546 CCCGCCTTGAGCACAGCCACAGG + Intergenic
1071197176 10:83175228-83175250 CCTACCCTTTTCAAAGGCACAGG + Intergenic
1071387728 10:85139309-85139331 CTTATCCTGTGGACAGGCACAGG - Intergenic
1071631541 10:87222753-87222775 CCCGCCTTGAGCACAGCCACAGG + Intergenic
1071644983 10:87354965-87354987 CCCGCCTTGAGCACAGCCACAGG + Intergenic
1071712497 10:88063274-88063296 CATTCTTTGTGCACAGGCATGGG + Intergenic
1072383978 10:94904957-94904979 CCTACCTTTAACACATGCACAGG - Intergenic
1072637386 10:97186510-97186532 GCTACCTGGGGCACAGGCACAGG - Intronic
1074191292 10:111139804-111139826 CCTGCCTTGTCCGCAGGCCCGGG - Intergenic
1075874914 10:125798183-125798205 ATTCCCCTGTGCACAGGCACTGG - Intronic
1075904484 10:126069097-126069119 CCTACCCAGTGCTCAGGCCCTGG - Intronic
1083272052 11:61577562-61577584 CCTAACTTGTGCCCAGTGACTGG + Intronic
1092021631 12:5207502-5207524 CCTACCTTGTGCAGAGAAATAGG + Intergenic
1092101126 12:5884597-5884619 CCTTCCTGGTGCCCAGGCAAAGG + Intronic
1092884096 12:12910612-12910634 CACACCTGGAGCACAGGCACAGG - Intronic
1093478763 12:19583458-19583480 CCTGCCTTCTGCACACCCACAGG - Intronic
1094848839 12:34373332-34373354 CCTCCCCAGTGCACATGCACGGG - Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1101838791 12:108313128-108313150 CCCACCCTGTTCCCAGGCACAGG + Intronic
1104910418 12:132237693-132237715 CCTCCCTTCTGCTCAGGCAAAGG + Intronic
1106370752 13:29130374-29130396 TCTTCCTTCTGCCCAGGCACCGG + Intronic
1107400187 13:40061944-40061966 GCCACCTTGTTAACAGGCACTGG - Intergenic
1107569227 13:41638913-41638935 CCTCCCTCCTGCTCAGGCACTGG - Intronic
1111221322 13:85208543-85208565 CTTGCCTTCTGCACAGACACAGG - Intergenic
1114647299 14:24262923-24262945 CTTTCCCTGTGCACAGGCTCCGG - Intronic
1115033676 14:28830485-28830507 CCTACCATGGACACAGGAACTGG - Intergenic
1116788842 14:49318172-49318194 CCTACATTAAGAACAGGCACAGG + Intergenic
1119760302 14:77146173-77146195 ACTCGCTTGTCCACAGGCACAGG - Intronic
1124636184 15:31366382-31366404 CCCACCCCATGCACAGGCACAGG + Intronic
1129032305 15:72628342-72628364 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1129217591 15:74108897-74108919 CCTAGCATGTGCCCAGGCCCAGG + Intronic
1129407068 15:75327088-75327110 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1129734752 15:77953198-77953220 CCTAGCATGTGCCCAGGCCCAGG + Intergenic
1129840838 15:78742793-78742815 CCTAGCATGTGCCCAGGCCCAGG - Intergenic
1132699822 16:1217576-1217598 CTTACCTGGTGGACAGACACTGG - Intronic
1132726194 16:1339312-1339334 CCTACTGTGTGCACAGGGTCTGG + Intronic
1132909840 16:2303822-2303844 CCTGCCCTGTGCACAGGGAGTGG - Intronic
1135818528 16:25658361-25658383 CCCACCTTGAGACCAGGCACTGG + Intergenic
1137059632 16:35778262-35778284 CCTTTCTTATGAACAGGCACTGG - Intergenic
1138764074 16:59578808-59578830 CCTACATTGTGGAAAGACACAGG + Intergenic
1147018290 17:37510202-37510224 TCCACCTTGTGTTCAGGCACAGG + Intronic
1148214557 17:45827330-45827352 CCGGCCTTGTTCACAGGCCCAGG - Intronic
1150367215 17:64599781-64599803 CCAACCTTCGGCACAGGGACCGG - Intronic
1152149322 17:78589118-78589140 CGTACCTGGGGCACAGGCAGTGG + Intergenic
1152427768 17:80227801-80227823 CCTACCCTGTGGACAGGCAGAGG - Exonic
1154450765 18:14473910-14473932 CCTGCCTTGGCCTCAGGCACTGG + Intergenic
1155282192 18:24251016-24251038 CCTCCCCTTTCCACAGGCACAGG - Intronic
1157022600 18:43805031-43805053 CCTTCCTTTTCCACAGGCAGAGG + Intergenic
1159604827 18:70464572-70464594 GCTACCTTGAACACAGGGACGGG - Intergenic
1160845488 19:1164318-1164340 CCTCCCCCGTGCACAGGAACAGG + Intronic
1161455015 19:4365721-4365743 CCTAGGCTGTCCACAGGCACAGG - Intronic
1164546954 19:29173856-29173878 CCTTCCTTTTCCACAGGCAGAGG - Intergenic
1164717483 19:30404175-30404197 CCTACCTTGTGCTCAGACCTGGG + Intronic
1166805515 19:45484755-45484777 TCTGCCTTGAGCACAGGCATGGG + Intergenic
1168236496 19:55066970-55066992 CCTACCATCTGCACAGGCCTTGG - Intronic
928458798 2:31450449-31450471 CCTACCCAGTACACAGGCACTGG - Intergenic
930944831 2:57061298-57061320 CCTCCCCTTTCCACAGGCACAGG + Intergenic
931632019 2:64310440-64310462 CCCACTGTGTGCACAGGCACTGG - Intergenic
931714242 2:65016422-65016444 CGTACCTAGGGCACAAGCACAGG - Exonic
937092686 2:119217057-119217079 CCTGCCTTGTGCAAGGGCAGAGG - Intergenic
939631192 2:144528302-144528324 CCAACATTGGGCCCAGGCACAGG + Intergenic
940288917 2:152059016-152059038 CCTGTCTTCTGCACAGCCACAGG - Intronic
940904453 2:159156738-159156760 CATAACCTGTGCACAGACACTGG - Intronic
942024356 2:171897658-171897680 GCTGCCTTGGGCACTGGCACAGG - Intronic
943482746 2:188441705-188441727 TCTACCTTGAGCCCAGGCCCAGG + Intronic
944354804 2:198774518-198774540 CCCACCTTTGGCAAAGGCACTGG - Intergenic
948938143 2:241181753-241181775 CCTACAATGGGCACAGGCAGGGG - Intronic
1172407575 20:34701068-34701090 TCTACCCTGTGTACAGGCAATGG - Intronic
1174569417 20:51491097-51491119 CCTAGCTTGTGGGCAGGCAGTGG - Intronic
1175989384 20:62780125-62780147 CCTGGCTTGTGCCCAGGCAGGGG - Intergenic
1176064806 20:63188863-63188885 CCAACCTCGTACACAGGCAGAGG + Intergenic
1176215815 20:63947251-63947273 CCTGCTGTGTGGACAGGCACTGG + Intronic
1180981794 22:19881771-19881793 CCTACATGGTCCACAGGCAGAGG + Intronic
1183064329 22:35352977-35352999 CCTACCTGGTGCAGGGGCCCAGG + Intergenic
1184177826 22:42799607-42799629 TCTACCCTGTCCACAGGCATGGG + Intronic
949911510 3:8913386-8913408 GCTGCCTGATGCACAGGCACAGG + Intronic
951101645 3:18694793-18694815 CCTACCTTGTGAAAAGCCAATGG + Intergenic
951593891 3:24296472-24296494 CCTACTATGTGCCAAGGCACAGG + Intronic
951865712 3:27304928-27304950 CCTACTTTGTGCAGAGCCCCAGG - Exonic
952507276 3:34018399-34018421 CCCACCATGTGAACAAGCACAGG - Intergenic
953366856 3:42352503-42352525 CCTACATGGTGGAAAGGCACAGG + Intergenic
953498681 3:43411944-43411966 CCTATCCTATCCACAGGCACAGG - Intronic
955298535 3:57756282-57756304 CCTACCCGGTGCACCGCCACGGG - Exonic
957227885 3:77473033-77473055 CCTCCCTTGTGCAGAGGGAGGGG + Intronic
957911476 3:86624538-86624560 CCTTCCTTGTGCAGAGGAAGGGG - Intergenic
961618425 3:128203487-128203509 CCTCCCTTGTGTGCGGGCACTGG + Intronic
962853091 3:139322557-139322579 GCTTCCTGGGGCACAGGCACTGG - Intronic
964097149 3:152945625-152945647 CCTAACTTGTTCTCAGGCAGAGG + Intergenic
968811878 4:2803729-2803751 CATAGCTTGTGCAAAGGCCCTGG - Intronic
969921960 4:10548701-10548723 CCTGCCCTGTGCAGAGGAACAGG + Intronic
971246273 4:24931381-24931403 CCTATCATGTGCTAAGGCACTGG - Intronic
972904511 4:43728424-43728446 CCTCCCCTTTGCATAGGCACAGG - Intergenic
973719092 4:53705369-53705391 CCTTCCCTCTGCACAGGAACAGG - Intronic
980259547 4:130430692-130430714 TCTTCCTTGTGCACAGGCTGAGG + Intergenic
985166422 4:187099675-187099697 CATACCTTGGGCAGAGGCCCCGG + Intergenic
988614897 5:32765886-32765908 CCCACCATGTTCACAGGCCCTGG - Intronic
988785578 5:34563344-34563366 CCTGCCATGTCCAAAGGCACCGG + Intergenic
989323665 5:40165514-40165536 CCTAGCTCCTGCACTGGCACTGG - Intergenic
989695878 5:44200295-44200317 CTTGCCTTCTGCACAGCCACGGG - Intergenic
990883760 5:60568930-60568952 CTTACCTTTTGCACACTCACAGG + Intergenic
991174204 5:63667848-63667870 GCAACCATGTGCAGAGGCACTGG + Intergenic
994631880 5:102296670-102296692 CCTCCCTTGAGCCCAAGCACTGG + Intergenic
995179923 5:109221537-109221559 TCTTCCTTGTGCTCAGACACAGG + Intergenic
997406913 5:133656408-133656430 CCTGCCATTTGCACAGGCAGTGG + Intergenic
997443802 5:133926856-133926878 GCTGCCTTGTGAGCAGGCACTGG - Intergenic
998096999 5:139401673-139401695 CCTGCCTTTGACACAGGCACTGG + Intronic
1000325538 5:160169325-160169347 CCTACCCTGTGCCCAGGAAGAGG - Intergenic
1002704318 5:181149946-181149968 ACTACCGTGTTCAGAGGCACAGG - Intergenic
1003260245 6:4510279-4510301 CATGCCTGTTGCACAGGCACTGG - Intergenic
1005310041 6:24550307-24550329 CCTACCTTGTGCACAGGCACCGG - Intronic
1007095564 6:39210633-39210655 CCAACCATGTGCCCAGGCACTGG + Intronic
1007725075 6:43911243-43911265 CCTACTGTGTGCACAGCCCCGGG - Intergenic
1011238158 6:85240497-85240519 CCTACCTAGTGCATAGGCTAGGG + Intergenic
1019190761 6:170249350-170249372 CCTGCCATGTTCACGGGCACCGG - Intergenic
1019278782 7:189475-189497 CCTCCCTTGTGCAGAGGCGGAGG - Intergenic
1024472305 7:49775963-49775985 CCTCCTCGGTGCACAGGCACGGG - Exonic
1027291163 7:76712449-76712471 TCTGCCTTGTGCACAGTCAGAGG + Intergenic
1029524518 7:101086894-101086916 CCTCCTGTGTGCACAGGTACTGG - Intronic
1034387003 7:150748350-150748372 GGTACCTTCTGCACAGGCAAGGG - Intronic
1041739081 8:61139577-61139599 CCTCCCTTCTGCACGGGCCCTGG - Intronic
1042710819 8:71715329-71715351 CCTCCCTTCTGCCCAGGCATGGG - Intergenic
1042984399 8:74566840-74566862 CCTCCCTTGTGAAAAGGCAGAGG + Intergenic
1046558554 8:115808348-115808370 TCTACCTTGTTCACATGGACGGG - Intronic
1049092173 8:140524535-140524557 CCTGCCTTGTGGAATGGCACAGG + Intergenic
1050582179 9:7070780-7070802 ATTACCTTGTTCACAGTCACAGG - Intronic
1054749112 9:68886468-68886490 CCTACCATGTTCCAAGGCACAGG + Intronic
1055674404 9:78640763-78640785 CCTACCTAATGCAAAGGGACTGG - Intergenic
1056702692 9:88924247-88924269 CCTGCCTGGAGCACAGGCTCTGG - Intergenic
1061484921 9:130915323-130915345 CCTTCCTTGGGCAGAGGCAAAGG - Intronic
1061729546 9:132603058-132603080 CCTGCCTTGGTCACAGGGACTGG + Intronic
1185468158 X:368134-368156 CCCACCCTGGGCACAGACACGGG + Intronic
1185468234 X:368319-368341 CCCACCTTGGGCACCGACACGGG + Intronic
1185468266 X:368393-368415 CCCACCTTGGGCACCGACACGGG + Intronic
1185468434 X:368764-368786 CCCACCTTGGGCACCGACACGGG + Intronic
1186503084 X:10067691-10067713 CTTACTTTGTGCCCAGACACTGG + Intronic
1189511412 X:41665859-41665881 CCTACCCTGGGCAGAGGCAGAGG + Intronic
1196232421 X:113239762-113239784 CCTTCCCTTTGCAAAGGCACAGG + Intergenic
1196331996 X:114481974-114481996 CCTCCCTTCTCCACAGGCAGTGG - Intergenic
1199170745 X:144732101-144732123 TGTACCTTCTGCACAGCCACAGG + Intergenic
1201011550 Y:9551911-9551933 CTTATCTTGTGCATAGACACAGG - Intergenic