ID: 1005312024

View in Genome Browser
Species Human (GRCh38)
Location 6:24567898-24567920
Sequence GTTTCTAAGGGGAAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005312024_1005312031 23 Left 1005312024 6:24567898-24567920 CCTCCCAATTTCCCCTTAGAAAC 0: 1
1: 0
2: 2
3: 13
4: 200
Right 1005312031 6:24567944-24567966 ATTCTCTCTACTTTTATGCATGG 0: 1
1: 0
2: 2
3: 21
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005312024 Original CRISPR GTTTCTAAGGGGAAATTGGG AGG (reversed) Intronic
901129997 1:6956230-6956252 GTTTCTAGTAGGAATTTGGGAGG + Intronic
901780910 1:11594000-11594022 GTTTCTTCTGGGAAGTTGGGAGG + Intergenic
906167363 1:43696782-43696804 GGTGCTATGAGGAAATTGGGGGG + Intronic
906821431 1:48934413-48934435 CTCTCTAAAGTGAAATTGGGAGG + Intronic
906987821 1:50705372-50705394 GTTTCTAAAAGGAATTTGAGGGG - Intronic
907305302 1:53509794-53509816 GTCCCTAAGTGGGAATTGGGGGG + Intronic
908929692 1:69303836-69303858 GGTTCTATGAGAAAATTGGGTGG - Intergenic
909660452 1:78076215-78076237 GTTTCCAAAGGAAAATTAGGGGG + Intronic
909958093 1:81802411-81802433 ATTTCCAAGAGGAGATTGGGGGG - Intronic
910810051 1:91226799-91226821 GTTTTTAAGGGTAATTTGGAGGG - Intergenic
910879319 1:91908120-91908142 GTTTCAAAGGGGCATTGGGGTGG + Intergenic
911150401 1:94592613-94592635 GTTTCTGAGGAGTATTTGGGTGG - Intergenic
911237335 1:95425521-95425543 GTTTGAATGGGGAAATTGGCTGG + Intergenic
914729229 1:150355879-150355901 GTTTGTAAGGAGAAATAAGGAGG - Intergenic
916328810 1:163592828-163592850 GTTTTTAAGAGGAAATTGCTGGG - Intergenic
918623671 1:186633848-186633870 GTTTTTAAGGGCAATTTGGTGGG - Intergenic
918961051 1:191278343-191278365 TTTTCTAATGGGAAATGAGGTGG + Intergenic
920837307 1:209523324-209523346 GTTTCTAAGCAGAGATGGGGTGG - Intergenic
924365630 1:243290421-243290443 TTTTCTATGGAGAAATTGGAGGG - Intronic
924745730 1:246831921-246831943 GTTTCTAAGAAAAAATTAGGAGG + Intergenic
1066071445 10:31818565-31818587 GTTTTTAATCGGAAAATGGGAGG - Intronic
1070645061 10:78196095-78196117 GTTGCACAGGAGAAATTGGGAGG - Intergenic
1070896451 10:79986499-79986521 GTTTCTATGGTGAAATAGGAAGG + Intergenic
1072121338 10:92407792-92407814 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
1072141699 10:92594375-92594397 GTGTCAGAGAGGAAATTGGGTGG + Intronic
1073785524 10:106885268-106885290 GTTTTTAAGGAGAAAATTGGGGG + Intronic
1076035883 10:127197614-127197636 GCTTCGGAGAGGAAATTGGGAGG + Intronic
1076342928 10:129761987-129762009 GTTTCTAATGGGAACTTGGGAGG - Intronic
1077616048 11:3674823-3674845 ATTTATAAGGGGAAATTTAGGGG - Intronic
1079111217 11:17606214-17606236 GCTTCTTAGGGGTAATTGGAAGG - Intronic
1080004392 11:27391260-27391282 ATTTCCAATGGGAAAATGGGGGG + Intronic
1080689566 11:34545113-34545135 GTGCCTAAAGGGAAATTGAGGGG + Intergenic
1080843727 11:36007793-36007815 CTTTCTGAGGGGAAACTGGCAGG + Intronic
1084800951 11:71543549-71543571 GTTTTTAAGGGCAACTTGGTGGG + Intronic
1087050526 11:93882280-93882302 GTTTTTAAGGATAATTTGGGGGG - Intergenic
1087170352 11:95043423-95043445 GTTTCTAGGAGGAAATCGGGAGG + Intergenic
1089034590 11:115373657-115373679 GATTCTAAGAAGAAAATGGGAGG + Intronic
1089827901 11:121295558-121295580 TTTTCTGAGGGCAAATTGTGAGG + Intronic
1092012205 12:5123853-5123875 ATTGCTAAGGGAAAATTGGAGGG - Intergenic
1092012211 12:5123888-5123910 ATTGCTAAGGGGAAATTTGAGGG - Intergenic
1092924907 12:13263867-13263889 GTTTTTAAGAGGAAATTGCTGGG + Intergenic
1093957855 12:25242375-25242397 TTTTCTAAGGTAAAATTTGGTGG - Intronic
1094603490 12:31931036-31931058 GTTTTTAAGGATAAATTGGTGGG - Intergenic
1095267760 12:40180290-40180312 GTTTTTAAGGGCAATTTGGTGGG - Intergenic
1096534813 12:52264741-52264763 GTTTGTAAGGGATAATTGGAAGG + Intronic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1097980845 12:65736769-65736791 GATTACAAAGGGAAATTGGGAGG + Intergenic
1101235623 12:102786720-102786742 GGTCCTAAGGGGAATTTGGGTGG - Intergenic
1101912617 12:108871809-108871831 GTTTTTAAGGGTAATTTGGTGGG - Intronic
1102763287 12:115408290-115408312 GTTTCTGAGGGGAAGGTGGAAGG + Intergenic
1104676417 12:130714942-130714964 GTTTCTAAGGGGAACAGTGGGGG - Intronic
1106414813 13:29537615-29537637 GTTCCTAATGGGAAATGGTGAGG + Intronic
1107868584 13:44727111-44727133 GTTTTTAAGGGTAATTTGGTGGG - Intergenic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1109856173 13:68130804-68130826 GTTTCTAAGGAGCTATTTGGAGG + Intergenic
1111993282 13:95137968-95137990 TTTTCTTTGGGGAAAGTGGGCGG + Intronic
1112433358 13:99372622-99372644 GAGTCTAAAGGGAAAATGGGTGG + Intronic
1113008486 13:105735741-105735763 GCTGCTCAGGGGAAAGTGGGTGG + Intergenic
1113416570 13:110132886-110132908 GTTTCTAAGGGGGCGTTGTGAGG - Intergenic
1115388994 14:32832582-32832604 TTTTCTAAGGGTAATTGGGGAGG - Exonic
1117447918 14:55822328-55822350 GTTTTTAAGGATAATTTGGGGGG + Intergenic
1118168356 14:63360063-63360085 GTCTAAAAGGGGAAAATGGGAGG - Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118705566 14:68477325-68477347 CTTTCTCAGGGGAAACTTGGGGG + Intronic
1120468228 14:84888626-84888648 GTTTCTATGGTGAAATTTGATGG + Intergenic
1122159136 14:99770077-99770099 CTATCTTAGGGGAAATGGGGGGG - Intronic
1125631451 15:41151010-41151032 GTTTCTAAGGATAACTTGGTGGG - Intergenic
1126064888 15:44819215-44819237 GCTTTTAAGGGGGAATTGTGGGG - Intergenic
1126094946 15:45081372-45081394 GCTTTTAAGGGGGAATTGTGGGG + Intergenic
1128048180 15:64638529-64638551 GTTACTGAGGGAGAATTGGGGGG + Intronic
1128103238 15:65023110-65023132 TTTTCTAAGGGGAAATTAGGTGG + Intronic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1130155008 15:81342869-81342891 GTGTCTAAGTGAAAATTAGGAGG + Intronic
1131082036 15:89544962-89544984 GTTTCTAGGGGGAAAATGACTGG - Intergenic
1131436724 15:92428666-92428688 ATTTCCAAGGGGAAATGGGGAGG + Intronic
1131446569 15:92502990-92503012 GTTTCTAAGGGGCAAAGGGATGG + Intergenic
1132031155 15:98439320-98439342 GTTTCTCAGGATAAATTGGTGGG - Exonic
1133041957 16:3065596-3065618 GGTTTTATGGGGAAAGTGGGGGG - Exonic
1134763714 16:16737186-16737208 GTTTCTAAGGTTAAAAGGGGAGG + Intergenic
1134982340 16:18621971-18621993 GTTTCTAAGGTTAAAAGGGGAGG - Intergenic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1138956404 16:61975769-61975791 GTTTTTAAGGGGAAAATGATAGG + Intronic
1141673331 16:85504320-85504342 GCCTCTAAGGGGAAAGTGTGTGG - Intergenic
1142813950 17:2410946-2410968 GTTTCTAAGGTGGAATTGGTGGG + Intronic
1143370676 17:6437087-6437109 CCTTCTCAGGGGAAGTTGGGAGG + Intergenic
1144318858 17:14093701-14093723 GATTGTAAGGGGGAATTGGAAGG - Intronic
1145083008 17:19911327-19911349 AATTCTAAGGTGAAATTTGGTGG - Intronic
1145186325 17:20797561-20797583 GTTTCTAATGAGAAATTCTGAGG - Intergenic
1146717718 17:35100350-35100372 CCTTCTAAGGGGAAATCAGGTGG + Intronic
1148010273 17:44473967-44473989 GTTTCTTAAGGGGAAGTGGGGGG + Intronic
1148236279 17:45971372-45971394 ACTTCTAAGTGGACATTGGGTGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1153106105 18:1529019-1529041 ATTTCTAATGTTAAATTGGGAGG + Intergenic
1153974295 18:10253835-10253857 GTTTCCCAGTGGAAAGTGGGTGG - Intergenic
1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG + Intergenic
1157766320 18:50299659-50299681 GTTTTTAAGGATAAATTGGTGGG + Intergenic
1157842663 18:50973770-50973792 GTTAATAAGGGGAAACTGAGGGG - Intronic
1158705007 18:59784424-59784446 GTTTTAAAGGGGAAAGTGGATGG + Intergenic
1160175152 18:76587575-76587597 GTTTCTAAGTTGCAATTGTGGGG + Intergenic
1164328830 19:24231724-24231746 ATTTCTAAGGTCAAACTGGGTGG + Intergenic
1164664436 19:30017111-30017133 TTTTCTAATGGAAAATTTGGTGG - Intergenic
1165122444 19:33569024-33569046 GTTTTTAAGGGTAACTTGGTGGG - Intergenic
1168064405 19:53910753-53910775 GTTCCTAAGTGGAATTGGGGAGG + Intronic
1168140232 19:54381025-54381047 GTCACGAAGGGGAAAGTGGGAGG - Intergenic
926914789 2:17880662-17880684 GTGTATGAGGGCAAATTGGGAGG + Intronic
927304148 2:21550967-21550989 GTTTCTAAGAAGAAATTGAGAGG + Intergenic
927399353 2:22693171-22693193 GTTTAAAAAAGGAAATTGGGAGG + Intergenic
929354142 2:40999070-40999092 GTTCCGAAGGGGAAATTGAGCGG + Intergenic
929511068 2:42566586-42566608 GTTCCTAAGGGGACATAGGGAGG + Intronic
929911498 2:46093426-46093448 CTTTGGAAGGGGAAATTGAGGGG - Intronic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
935199499 2:100844107-100844129 GTATTGAAGGAGAAATTGGGTGG - Intronic
936870732 2:117132100-117132122 TTTTCTAAGAGGAAATTTTGGGG - Intergenic
938251054 2:129816027-129816049 GTTTTTAAGGGGAATATGGAGGG + Intergenic
945186808 2:207147688-207147710 CTTTCTCAGAGGGAATTGGGTGG - Intronic
946137662 2:217661105-217661127 GTGGCTAAGGGAAAATAGGGAGG - Intronic
946578970 2:221105824-221105846 CATTCTAGGGGGAAATTGGTGGG - Intergenic
947310447 2:228796013-228796035 ATTTCAAAGGGGAAATGGTGAGG + Intergenic
947703017 2:232251030-232251052 GCTTCTAATGTGAAATAGGGAGG + Intronic
1168941802 20:1719068-1719090 GTTTTTAAGGGTAAGTTGGTGGG + Intergenic
1172692831 20:36802447-36802469 GTTCCCATGGGAAAATTGGGAGG - Intronic
1173158305 20:40633543-40633565 GTTCCTTATGGGAAGTTGGGAGG - Intergenic
1174791993 20:53487503-53487525 GTTTGTAACAGGAAAGTGGGGGG + Exonic
1175464999 20:59184924-59184946 GTTTGTGGGGGGGAATTGGGAGG + Intergenic
1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG + Intergenic
1181599117 22:23938542-23938564 CTTTCTTATGGGAAATTGTGTGG + Intergenic
1182429899 22:30293306-30293328 GTCTCTCAGGGGCAATTAGGTGG - Intronic
950511826 3:13433895-13433917 GTTTTTAAGGAGAACTTGGTGGG - Intergenic
951864754 3:27295233-27295255 GTGGATAAGGGGATATTGGGTGG - Intronic
954158557 3:48702760-48702782 GTTTTCAAGTGGAAATTGGGTGG - Intronic
957225211 3:77434313-77434335 GTTGCAAATGGGAAATTTGGGGG - Intronic
957525158 3:81371079-81371101 GTTTGTGAGGGGGATTTGGGAGG + Intergenic
957726595 3:84073904-84073926 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
961910172 3:130306643-130306665 GTTTTTAGGGGCAAATTGGCTGG + Intergenic
963108057 3:141663509-141663531 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
964480033 3:157130761-157130783 GATGCTCACGGGAAATTGGGTGG - Intergenic
964497172 3:157303780-157303802 GTTTCTAAGTGGCAATGGTGAGG - Intronic
964500820 3:157346451-157346473 GTTTCTAAGTTGAAATTAGATGG + Intronic
964921103 3:161896649-161896671 GTTTCTAAGGATAATTTGGTGGG - Intergenic
967210034 3:187160163-187160185 GTTTTTAAGGACAACTTGGGAGG + Intronic
967672835 3:192259604-192259626 GTTTGTAAGTAGAAATAGGGTGG + Intronic
967962247 3:194935120-194935142 GTTTCTAAGGATAATTTGGTGGG + Intergenic
968781266 4:2583454-2583476 GTTTCTGAGTGGAGATTGAGAGG + Intronic
971449229 4:26784566-26784588 GTTTCTGATGGGCAATTGGGTGG - Intergenic
972903145 4:43710204-43710226 GTTTCCAAGGGGACATTCTGAGG - Intergenic
976031084 4:80754522-80754544 GTTTTCAAGGGGAAAGTGAGAGG + Intronic
976738201 4:88332245-88332267 TTTTCTAATTGGCAATTGGGTGG + Intergenic
977051041 4:92128883-92128905 TTTTCTATGGGGAAATTAAGGGG + Intergenic
978319339 4:107477167-107477189 GTTTTTAAGGAGAACTTGGTGGG + Intergenic
978365085 4:107973044-107973066 GTTTTTAAGGGTAAATTGGTAGG - Intergenic
980516298 4:133867012-133867034 GTTTCTCAGGGCACTTTGGGGGG - Intergenic
980989865 4:139729998-139730020 GTTTCTTAGAGGAAATTGACAGG - Intronic
981938038 4:150255065-150255087 CTTTCTAAGATGAACTTGGGTGG - Intronic
984929103 4:184830973-184830995 GTTAATCAGTGGAAATTGGGTGG - Intergenic
985200594 4:187481120-187481142 GTTTAAAAGGTAAAATTGGGAGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
987192754 5:15496082-15496104 GATTCTCAGGGGTAATTTGGAGG - Intergenic
987833563 5:23131113-23131135 GTTTCTTCAGAGAAATTGGGTGG - Intergenic
988698195 5:33645300-33645322 GTTTCTAGTGGGGAAGTGGGGGG - Intronic
989955911 5:50359668-50359690 TTTTCTAAGGGGCAATGTGGTGG - Intergenic
990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG + Intergenic
994778320 5:104062791-104062813 GTTTCTAAGGATAACTTGGTGGG - Intergenic
996622422 5:125523826-125523848 ATTTCTAAGGGGTATTTGGGAGG + Intergenic
999859267 5:155627956-155627978 ATTTTTAAGGGGAAATTGGAGGG + Intergenic
1000091640 5:157934681-157934703 GTTTTTAAGGAGAATTTGGTGGG + Intergenic
1000678703 5:164156689-164156711 GTTTCTAAGAGGCATTTGAGAGG + Intergenic
1001029075 5:168248421-168248443 GTTGCTGTGGGGAACTTGGGAGG + Intronic
1003454277 6:6266732-6266754 GTTACAAAGTGGAAAGTGGGGGG - Exonic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1006729839 6:36228681-36228703 GGTACTAAGGGGAAATTGACAGG + Intronic
1007824582 6:44590385-44590407 TTTTTAAAGGGGAAATTGAGTGG + Intergenic
1010109397 6:72207793-72207815 TTTTCTCAGTGGAATTTGGGGGG - Intronic
1011367958 6:86602267-86602289 CTTTCTAAGAGGAAATTGCTGGG + Intergenic
1015268612 6:131315905-131315927 GATTCTAGGGGGAAAATGAGTGG + Intergenic
1017131878 6:151114700-151114722 TTTTCTAAGGGCACCTTGGGTGG - Intergenic
1017494908 6:154975084-154975106 GTTTCTAAGTGGCAACTGAGTGG + Intronic
1017922958 6:158887298-158887320 GTCTCTAAGAGGAAATTGTTGGG + Intronic
1019803864 7:3108186-3108208 GTTTCTAAGGATAATTTGGTGGG - Intergenic
1019843024 7:3468411-3468433 GTTTCTATGGGTAGATTCGGGGG - Intronic
1020070626 7:5224562-5224584 GTTTTTAAGGATAACTTGGGTGG + Intronic
1021217391 7:17933693-17933715 GGTCCTGAGGGGAAATTAGGAGG - Intronic
1022589299 7:31645928-31645950 GTTTGTAAGGGGAAAATGTTAGG + Intronic
1027793568 7:82662325-82662347 GTTCCTGGGGGGAAATGGGGAGG + Intergenic
1028637628 7:93007313-93007335 GTTTTTAGGGGAAACTTGGGAGG + Intergenic
1028740117 7:94264923-94264945 GCTTCTCAGGGGAAATTGGAAGG + Intergenic
1035044168 7:155953113-155953135 GAGTCTAAGGGGTAATTGGTTGG + Intergenic
1035288762 7:157823867-157823889 GTCTCTAAGGGGAATCTGGAGGG + Intronic
1038537891 8:28367613-28367635 GTTTCTGAGAGCAAATGGGGAGG - Intronic
1039345927 8:36705119-36705141 GTTTTTAAGGGTAATTTGGTGGG + Intergenic
1039408769 8:37334625-37334647 GTTACAAATGGCAAATTGGGAGG - Intergenic
1039550884 8:38442091-38442113 GCTTCTAAGGCCATATTGGGTGG + Intronic
1042524537 8:69750423-69750445 TTTTCTAACGGGGAATGGGGAGG - Intronic
1045696402 8:104813389-104813411 GTTTCAAAGGAGAGATAGGGCGG + Intronic
1046510635 8:115198045-115198067 GTTTTTCAGGGGGAAATGGGAGG - Intergenic
1048661461 8:136607349-136607371 TTTTCGAAGGGGAATTTAGGGGG + Intergenic
1050109122 9:2196442-2196464 ATCTCTAATGGGAAATTGAGAGG - Intergenic
1050117544 9:2277371-2277393 GTTTTTAAGAGGAAATTGCTGGG - Intergenic
1053040800 9:34869583-34869605 ATTTGTAAGGGTAAAGTGGGAGG - Intergenic
1055030927 9:71770545-71770567 TTTTATAAGGGGAAAGGGGGTGG + Intronic
1057431137 9:94995288-94995310 GTTTCTGAGGGGAAAGAGGAAGG + Intronic
1057456112 9:95213180-95213202 GTTGCTAATGGGAAATATGGGGG + Intronic
1058576099 9:106403369-106403391 GATTCTTAGGGGTAATTAGGAGG - Intergenic
1059694960 9:116722329-116722351 GTTTCTAAAGGTACATTGTGTGG - Intronic
1060570547 9:124635175-124635197 GTTTCCAAGGGTTAATGGGGAGG - Intronic
1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG + Intronic
1187212844 X:17246914-17246936 CTTCCTAAAGGGAACTTGGGAGG + Intergenic
1187684733 X:21804956-21804978 CTTTCTAATGGGAAATGGTGGGG - Intergenic
1188910359 X:35839810-35839832 GTTTTTAAAGGGTACTTGGGTGG + Intergenic
1190416899 X:50189199-50189221 ATTTCTAAGGGAAACTTGTGTGG - Intergenic
1190477519 X:50842594-50842616 GTTTTTAAGGGCAACTTGGTGGG + Intergenic
1192234289 X:69286032-69286054 GCTTCCAAGAGGAAATGGGGAGG + Intergenic
1192324308 X:70119204-70119226 GTTTCTAAGGGGATCATGGAGGG + Intergenic
1195258604 X:103112159-103112181 GTTTTTAAGGAGAACTTGGTGGG - Intergenic
1198129933 X:133683431-133683453 ATTTCCAAGAGGAAATTAGGAGG + Intronic
1199910487 X:152281551-152281573 GTTTCTAAGGAGAAAGTCAGAGG - Intronic