ID: 1005315506

View in Genome Browser
Species Human (GRCh38)
Location 6:24599398-24599420
Sequence CAGCTTGGACAGCTTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 3, 2: 16, 3: 23, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005315506_1005315518 16 Left 1005315506 6:24599398-24599420 CCAATGCCAAGCTGTCCAAGCTG 0: 1
1: 3
2: 16
3: 23
4: 136
Right 1005315518 6:24599437-24599459 GGGCCATGCAGGACATGGCATGG 0: 1
1: 2
2: 13
3: 46
4: 423
1005315506_1005315512 -4 Left 1005315506 6:24599398-24599420 CCAATGCCAAGCTGTCCAAGCTG 0: 1
1: 3
2: 16
3: 23
4: 136
Right 1005315512 6:24599417-24599439 GCTGGAGGCCACCCTGCAGTGGG 0: 2
1: 3
2: 17
3: 52
4: 293
1005315506_1005315514 5 Left 1005315506 6:24599398-24599420 CCAATGCCAAGCTGTCCAAGCTG 0: 1
1: 3
2: 16
3: 23
4: 136
Right 1005315514 6:24599426-24599448 CACCCTGCAGTGGGCCATGCAGG 0: 1
1: 0
2: 4
3: 39
4: 315
1005315506_1005315511 -5 Left 1005315506 6:24599398-24599420 CCAATGCCAAGCTGTCCAAGCTG 0: 1
1: 3
2: 16
3: 23
4: 136
Right 1005315511 6:24599416-24599438 AGCTGGAGGCCACCCTGCAGTGG 0: 3
1: 12
2: 15
3: 34
4: 281
1005315506_1005315517 11 Left 1005315506 6:24599398-24599420 CCAATGCCAAGCTGTCCAAGCTG 0: 1
1: 3
2: 16
3: 23
4: 136
Right 1005315517 6:24599432-24599454 GCAGTGGGCCATGCAGGACATGG 0: 1
1: 2
2: 20
3: 51
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005315506 Original CRISPR CAGCTTGGACAGCTTGGCAT TGG (reversed) Intronic
901301042 1:8200345-8200367 CAGCTGGGACAGGTTGGAAAGGG + Intergenic
901617430 1:10552966-10552988 CAGCTTGGAAAGGTGGGCAAAGG + Intronic
904773889 1:32895239-32895261 CAGCTTGGGCACCCTGGCAGGGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
908698831 1:66875583-66875605 CAGCTGGGAGAGTTTGGAATTGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
917365327 1:174225341-174225363 CAACTGGGACATCTTGGGATTGG + Intronic
923270206 1:232348406-232348428 CAGCTGGGACGTCTTGGCAATGG + Intergenic
1067853519 10:49770092-49770114 GGGCTGGGACAGCTTGGCTTTGG + Intergenic
1073589455 10:104742615-104742637 GACCTTGGACAGCTGGGCCTGGG + Intronic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1074604070 10:114943037-114943059 TTGCTTGGACAGCTTGCCCTTGG + Intronic
1075438554 10:122462026-122462048 CAGCTGGCACAGGTTGGCGTAGG - Exonic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1088674515 11:112179504-112179526 CAACTTGGATTTCTTGGCATGGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1090262687 11:125332836-125332858 CTGCTTGGAGAGCTGGGCAAAGG - Intronic
1090383947 11:126345752-126345774 CAGTGTGGACAGCGTGGCCTGGG + Intergenic
1202811794 11_KI270721v1_random:30236-30258 CAGCCTGGACACCTTGGAACTGG + Intergenic
1091991493 12:4959693-4959715 GAGCTTGGACATCTGGGCAGTGG - Intergenic
1092955475 12:13545417-13545439 CACCTAGAACAGCCTGGCATGGG + Exonic
1095810344 12:46367936-46367958 CAGCTTGGACAACATAACATAGG + Intronic
1096518728 12:52172332-52172354 CAGCTGGGCCAGCTTGGTCTTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1102035407 12:109768315-109768337 CAGCTTGGTCCGCTTGCCCTCGG - Exonic
1102515471 12:113443348-113443370 CTGATTGGACAGCTTGGCTCCGG - Intergenic
1102883998 12:116508270-116508292 GAGCTTGCAGAGCTTGGCGTTGG - Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1116729446 14:48603482-48603504 CAGCTTGGCCACATTGGAATAGG + Intergenic
1119655311 14:76413268-76413290 CAGCATGGACAGGTGGGCAGAGG - Intronic
1119756160 14:77121187-77121209 CAGATGGGAGCGCTTGGCATGGG + Intronic
1122055356 14:99094375-99094397 CGGCTTGGACAGCTGGACAGAGG - Intergenic
1122345490 14:101056157-101056179 CAGCCTGGGCAGCTTGGGAGTGG - Intergenic
1122834466 14:104424113-104424135 CAGCTAGGACAGCAAGGAATGGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126367938 15:47915270-47915292 CAGCATGGACAGCTGAACATGGG + Intergenic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127647468 15:60973084-60973106 CAGTTTGGTCAGCAGGGCATGGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1132939704 16:2500648-2500670 CAGCCTGGACAGCTGGTCCTGGG + Intronic
1133988256 16:10684780-10684802 CAGCAGGGTGAGCTTGGCATTGG - Intronic
1137613999 16:49836300-49836322 CAGCTTGGACAGGTTGGAGGTGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1143091740 17:4452964-4452986 CAGCTGGGTGAGCTTAGCATAGG - Intronic
1144826551 17:18108584-18108606 CAGCCTGGAGAGCTGAGCATGGG - Intergenic
1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG + Intronic
1151184166 17:72351150-72351172 CCTCTGGGACAGCATGGCATGGG + Intergenic
1151548648 17:74808609-74808631 AAGCTTGGAGAGCTTGGGAAGGG + Intronic
1152586240 17:81190680-81190702 CAGCGTGGCCAGCTCGGCCTTGG + Exonic
1153320137 18:3764889-3764911 CAACTTTGTCAGCTTGGAATTGG + Intronic
1155537473 18:26832228-26832250 CAGTTTGAACAGCATGGGATAGG + Intergenic
1156453342 18:37279088-37279110 CAGCTTAGGCAGCTGGGCAGTGG - Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157427226 18:47594317-47594339 CTGCTTTGAGGGCTTGGCATAGG - Intergenic
1159570082 18:70102959-70102981 CAGACTGGACAGCTGGGCAGAGG - Intronic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1164867221 19:31614627-31614649 CATGTTGGACAGCTTGGCTCTGG + Intergenic
1166473063 19:43096874-43096896 CAGCTTCCACAGCTTGTGATGGG - Intronic
1167502269 19:49854928-49854950 CAGCTGGGTCAGCCAGGCATGGG - Intronic
1168592198 19:57646686-57646708 GTGCTTGGCCAGCTTGGGATTGG - Intergenic
925294413 2:2767967-2767989 CCTCATGGACAGCCTGGCATGGG - Intergenic
927007028 2:18861531-18861553 CAGCCTAGAGGGCTTGGCATGGG - Intergenic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG + Intergenic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG + Intergenic
932134347 2:69215157-69215179 CTACTTGGAGAGCTTGGAATGGG - Intronic
935102083 2:100006653-100006675 GAACTTGGAGAGCTTGGCCTTGG + Exonic
938259286 2:129883677-129883699 CTGTTTGGAGAGCTGGGCATGGG + Intergenic
938758814 2:134405203-134405225 AAACTTGGACATCTTGGCCTGGG - Intronic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945062746 2:205923339-205923361 CAGCTTGGGCAGCATGCCAAGGG - Intergenic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
948455567 2:238102989-238103011 CATCCTGGACTGCTTGGCAAAGG + Intronic
1169190143 20:3653542-3653564 CAGCTTCGACTGCATGGCCTGGG + Intergenic
1169355166 20:4899332-4899354 CAGCTTGGACAACTGGGTAGGGG + Intronic
1170874769 20:20240274-20240296 CAGCTTGGGAAGCTTGGCTAGGG + Intronic
1172079249 20:32326300-32326322 CAGCTTGGACAACGAGCCATGGG + Intronic
1175869357 20:62200911-62200933 GAGCTGGGACAGATTGGCTTGGG - Exonic
1176150649 20:63589082-63589104 CAGCTTGGGCTGCTTGGCCACGG - Exonic
1176852999 21:13936198-13936220 CAGATGGGACAGCCTGGCAGAGG + Intergenic
1178240570 21:30894895-30894917 CAGCTTGGACAACTTCACAGTGG - Intergenic
1178693001 21:34765317-34765339 CAGCTTTGACAGCATGTCATGGG + Intergenic
1180032892 21:45224432-45224454 CTGCCTGGACGGCTTGGGATAGG - Exonic
1180913846 22:19471771-19471793 CAGTTTGAACAGCATGGGATAGG + Exonic
949326494 3:2871103-2871125 CTGCCTGGACTGCTTGGCTTCGG - Intronic
950424754 3:12919125-12919147 CTGCTTGGACACCTGGGCCTGGG + Intronic
950980861 3:17303067-17303089 CAGATTGGACAGAGTTGCATGGG - Intronic
951509178 3:23482515-23482537 CAGCGTGGGCAGCATGACATAGG - Intronic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
952897259 3:38085876-38085898 AAGCTTCTACAGCTGGGCATAGG + Intronic
953192578 3:40701472-40701494 CTGCTTGGTGAGCTTGGCTTTGG + Intergenic
953715009 3:45309981-45310003 CAGCTTGGACAGTGTGGCACTGG - Intergenic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
958756940 3:98260601-98260623 CAGCCTGGACAGCTAGGAAAGGG + Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963437794 3:145293709-145293731 CAGCTTGGACTCATTGGCTTTGG - Intergenic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
966529743 3:180962925-180962947 CAGCTGCGACAGATTGGTATGGG + Exonic
966901817 3:184492206-184492228 GCGCCTGGACAGGTTGGCATTGG + Intronic
967224271 3:187275905-187275927 CAGCTTGTAAAGCCTGCCATTGG + Intronic
967887270 3:194341758-194341780 CAGGTTGGACAGGTGGGCAAAGG + Exonic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
972492399 4:39600203-39600225 CACATTGGAGAGCCTGGCATGGG - Intronic
976612857 4:87047548-87047570 CAGTTTGGTGAGCTTGGCTTTGG - Exonic
976853740 4:89578912-89578934 AAGCTTGGCCAGCTTTGCAGAGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978101700 4:104849347-104849369 CAGCTTGGAGGGCTTCCCATTGG - Intergenic
978201631 4:106029260-106029282 CTGCTTTCACAGGTTGGCATTGG - Intergenic
978391909 4:108235940-108235962 CAGCCAGGACAGCTTCCCATGGG - Intergenic
980416799 4:132499351-132499373 AATCTTTGACATCTTGGCATTGG + Intergenic
982032734 4:151316857-151316879 AAGCTTGGATAGCTTGACACAGG - Intronic
983153185 4:164311494-164311516 CAGTTTGGACAGATGGTCATTGG - Intronic
987118485 5:14744962-14744984 CAGAATGGGCAGCTTGGCCTTGG - Intronic
988488050 5:31683127-31683149 CAACTTTTACAGCTTGGCTTTGG + Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
999453215 5:151694023-151694045 CAGTGTGGACAGCTAGGCCTGGG + Intergenic
1003383413 6:5645763-5645785 GTGCTTTGACAGATTGGCATGGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1005952964 6:30644967-30644989 AAGCTTTGACATCTTGGCAAAGG - Intronic
1007733903 6:43968526-43968548 CAGCTTGGTCAGGCTGGCCTGGG - Intergenic
1008472947 6:51904335-51904357 CAGTTTGAACAGCTAGGAATGGG - Intronic
1008572018 6:52825470-52825492 CAGATGGGGCAGCTTGGCAGAGG - Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1012428622 6:99141860-99141882 CAGATTGGACAGCCAGGCAGAGG - Intergenic
1013344246 6:109244562-109244584 CAGCTTGGTCAGGTGGTCATTGG + Intergenic
1013479177 6:110538532-110538554 CCGCTTGGGCAGCTTTGCAGTGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019573778 7:1726472-1726494 GAGCTGGGCCAGCTTGGCCTTGG - Intronic
1019743696 7:2688213-2688235 CAGCGTGGGCAGCTCGGCCTGGG - Intronic
1022477031 7:30717899-30717921 CAGCTAGGAAATCTTGGAATAGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG + Exonic
1029400802 7:100344654-100344676 CAGCTTGTCCAGCCTGGCCTGGG - Intronic
1032840922 7:135712971-135712993 CAGCCTGGACAGCTAGCCAAGGG - Intronic
1032884109 7:136119410-136119432 CAGCTTGCACAGCTTGCCTGTGG + Intergenic
1033728430 7:144147188-144147210 CTGCTGGGATAGCCTGGCATTGG - Intergenic
1034487633 7:151375968-151375990 CAGCTTGGACAGCCTCGGGTGGG + Intronic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1035095900 7:156355179-156355201 CAGCATGGAAAGCATGCCATGGG - Intergenic
1039392291 8:37191041-37191063 CAGCTTGAACAGATTGCAATTGG + Intergenic
1039694486 8:39896238-39896260 CAGCCTGGGCAGCATGGCAAAGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1043476457 8:80610436-80610458 CAGCATGGACAGCCCGGCAATGG - Intergenic
1043783418 8:84365931-84365953 CCGCATGGACACGTTGGCATTGG + Intronic
1044459517 8:92428688-92428710 CAGCTTCCACAGCTTGGAATGGG + Intergenic
1048554267 8:135458606-135458628 CAGCCTGCAAGGCTTGGCATGGG - Intronic
1051602720 9:18890831-18890853 CATTTTGCACAGCTTGGCAAGGG - Intronic
1052169856 9:25379727-25379749 CACCTTGGACAGCTTGGTAAAGG + Intergenic
1052388281 9:27848057-27848079 CAGATTGGGCTGCTTGGCAGAGG + Intergenic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1053231281 9:36412172-36412194 GAGCTTGGAGAGGTGGGCATGGG - Intronic
1055597996 9:77885039-77885061 GACTTTGGACAGCTTGGTATAGG - Intronic
1055841666 9:80512644-80512666 CAGGTTGGACATGTAGGCATTGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060027390 9:120184762-120184784 CACCTTGGACAACTTGCCTTTGG - Intergenic
1062105801 9:134754161-134754183 TGGCTTGGACAGCCAGGCATGGG + Intronic
1203372113 Un_KI270442v1:317202-317224 CAGCATGGCCAGGTCGGCATAGG - Intergenic
1187063889 X:15814252-15814274 CAGCCTGGTCAGCTTAGCCTTGG + Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1192221077 X:69197735-69197757 CAGCTTGGGCTGCCTGGCCTGGG - Intergenic
1193986552 X:88248848-88248870 CAGCATAGACACCTGGGCATGGG + Intergenic