ID: 1005325552

View in Genome Browser
Species Human (GRCh38)
Location 6:24696667-24696689
Sequence ACCATGATATTATACCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005325551_1005325552 3 Left 1005325551 6:24696641-24696663 CCACTCACAGCTCAGCTCTAACT 0: 1
1: 0
2: 1
3: 19
4: 248
Right 1005325552 6:24696667-24696689 ACCATGATATTATACCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005325552 Original CRISPR ACCATGATATTATACCCTGA TGG Intronic
No off target data available for this crispr