ID: 1005326370

View in Genome Browser
Species Human (GRCh38)
Location 6:24705041-24705063
Sequence ATGAAGAAAAGCTTTGCTTA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 328}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005326370 Original CRISPR ATGAAGAAAAGCTTTGCTTA AGG (reversed) Exonic
902222922 1:14978203-14978225 TTGAAGAAAAGCTCTGATTCAGG - Intronic
902446678 1:16470580-16470602 TTTAACAAAAGCTGTGCTTAGGG - Intergenic
902974094 1:20076257-20076279 ATCAAGCAAAGCATTTCTTAGGG + Intronic
903089884 1:20904141-20904163 ATGAAGAAAAGTTATGTTTCTGG + Intronic
903437207 1:23359523-23359545 ATGTAGAACAGTTTTCCTTATGG - Exonic
905352076 1:37354838-37354860 AGGGACAAAAGCTTTTCTTAGGG - Intergenic
905460300 1:38118490-38118512 TTGAAGGGAAGCTTTGCTCAAGG + Intergenic
907939984 1:59078238-59078260 ACGAACAAAAGCTCTGGTTAGGG - Intergenic
908056766 1:60295892-60295914 ATGAAGAAAATATATGCTGATGG + Intergenic
908146109 1:61246093-61246115 TTGAAGACAAGCTTTGCATATGG + Intronic
908278457 1:62502529-62502551 ATGAGAAAAATCTTAGCTTATGG - Intronic
908324326 1:63008601-63008623 ATGAAGAAAAGCTATCCCCAGGG + Intergenic
908687773 1:66741415-66741437 ATCAAGAAAAGGTTTGCTGCAGG + Exonic
908980729 1:69954117-69954139 ATGAAGATAAGCTTTCCGTAAGG + Intronic
909569411 1:77091375-77091397 GTGAAGAAAATGTATGCTTATGG - Exonic
909810023 1:79922037-79922059 CTGAAGAATAGGGTTGCTTAAGG + Intergenic
909909284 1:81241974-81241996 ATGAGGAAAAGGTTTCCTTTCGG + Intergenic
910312811 1:85845503-85845525 ATGAAGAAAACCTTGTCTTGTGG - Intronic
911262289 1:95701268-95701290 ATGGAGATAAACTCTGCTTAGGG + Intergenic
911997354 1:104783634-104783656 TTGAGGCAAAGCTTTGCATACGG + Intergenic
914374363 1:147060774-147060796 ATGAAGAAAAGCTCTGATATGGG - Intergenic
914797468 1:150932810-150932832 ATGCAGCAAAGCAATGCTTACGG - Intronic
915927456 1:160033800-160033822 ATGAAGAAAACCAAGGCTTATGG + Intergenic
916105981 1:161432762-161432784 AGGAAGAAAAATTTTGCTTGTGG + Intergenic
916859185 1:168785001-168785023 GAGAAGAAAGGTTTTGCTTAAGG - Intergenic
917282321 1:173390205-173390227 CTGAAGAAAAGTGTTTCTTAAGG - Intergenic
918802581 1:188990722-188990744 ATAAAGAAATGCTTCGCTTAAGG - Intergenic
919294213 1:195673788-195673810 TTGATGAATAGCTTGGCTTAAGG - Intergenic
921356464 1:214288955-214288977 CTGAAGAATGGATTTGCTTAAGG - Intronic
924273473 1:242359439-242359461 ATGAAGAAAAGCATTGACTCAGG + Intronic
924731282 1:246713814-246713836 AAGAAGACAAGGTTGGCTTATGG - Intergenic
1063089682 10:2851260-2851282 ATGCATAAAAACTTTTCTTACGG + Intergenic
1065052122 10:21804591-21804613 CTGAAGAAAAGTTATCCTTATGG + Intronic
1065242078 10:23716185-23716207 ATGAAACAAAACTATGCTTAGGG + Intronic
1066444050 10:35465606-35465628 AAGAAGAAAAGCTGTGGGTAAGG - Intronic
1066711244 10:38237215-38237237 ATGAAGAAAAGCATTGACTCAGG - Intergenic
1066977027 10:42378542-42378564 AGGGAGAAAAGCATTGCCTATGG + Intergenic
1067200306 10:44164768-44164790 ATGAAGACAAGCTCTGCTATTGG + Intergenic
1068062020 10:52079951-52079973 ATAAAGAAAAGCTGTTCTGATGG + Intronic
1068087013 10:52386701-52386723 ATGATGAAAAGGTTTGTTTTTGG - Intergenic
1068139627 10:52989460-52989482 ATGAAGAATAGCTTTTTTCAAGG - Intergenic
1068212265 10:53935230-53935252 ATTAAGAAAAGCTTATCTTAGGG - Intronic
1070483878 10:76911471-76911493 ATGATGAAATGCTTTGCCCAAGG - Intronic
1071206546 10:83286245-83286267 GTGAAGAGAATATTTGCTTAAGG + Intergenic
1071774529 10:88770390-88770412 ATGTAGAACAGTTTTTCTTAAGG - Intronic
1071894840 10:90054695-90054717 ATTAAGACAAGCATTGCTTCAGG + Intergenic
1071930571 10:90465321-90465343 ATGATGCAAAGCTTTTCATATGG + Intergenic
1072356725 10:94618774-94618796 ATAAAGCAAAACTTTGTTTATGG - Intergenic
1072466556 10:95668373-95668395 ATGAAGAAAAGATCTACTCAAGG + Intronic
1073640058 10:105243314-105243336 ATGCAGACAAACTTTGCCTAAGG + Intronic
1073893787 10:108130582-108130604 ATGAAGAAGAGCATTGCTCTGGG - Intergenic
1074249716 10:111732433-111732455 AGGAAGAGAAAGTTTGCTTAGGG - Intergenic
1074443609 10:113499908-113499930 AGGAAGAAAAGCCTTACTAAGGG - Intergenic
1075230261 10:120670420-120670442 ATAAATCAAAGCTTTGCTTTTGG - Intergenic
1075666708 10:124235994-124236016 ATGAACAAAACCTGTGCTCATGG + Intergenic
1077873732 11:6284840-6284862 AGAAAGAAAAGCATTGCTTGTGG - Intergenic
1078474017 11:11614941-11614963 AAGAAGAAAAGCCTTGCCAAAGG - Intronic
1078668372 11:13344222-13344244 ATGAAAAAATGATTTGCTTGTGG - Intronic
1079588694 11:22156239-22156261 ATGTGGAAGGGCTTTGCTTATGG - Intergenic
1079826921 11:25207656-25207678 ATTAATAAATTCTTTGCTTAGGG - Intergenic
1080081975 11:28231825-28231847 ATGATGAAAAGCTTGGATAAAGG - Intronic
1083031319 11:59595357-59595379 TTTAAGTAAAGCGTTGCTTAAGG - Intronic
1083826887 11:65208968-65208990 GAGGAGAAAAGCTCTGCTTAAGG - Intronic
1085014106 11:73161236-73161258 ATGATGAAAAGCTTTGGAAATGG - Intergenic
1086789072 11:91012292-91012314 TTCAACAAAAGCATTGCTTATGG + Intergenic
1087974185 11:104524192-104524214 ATGATGAAAACCTTTGATTGGGG - Intergenic
1088841097 11:113628250-113628272 ATCAAGAAAAGATTTTATTATGG - Intergenic
1091212065 11:133870503-133870525 AGGAAGAAAAGATGTGCTCAAGG + Intergenic
1091363519 11:134998034-134998056 GTGCAGAAAAGCTCTGCTTCTGG + Intergenic
1091636740 12:2202926-2202948 ATGAAGAGATGCTTTGCTTCTGG + Intronic
1092384995 12:8029576-8029598 ATAAAGAATAGTTTTGCTCAAGG + Intergenic
1093865961 12:24227737-24227759 AGTGAGAAAAGCTTTGCTAAGGG + Intergenic
1093890148 12:24510336-24510358 AAGAATAGATGCTTTGCTTATGG + Intergenic
1094092138 12:26662184-26662206 AAGAAAAAAAGATTTGCTTGAGG - Intronic
1094883175 12:34820021-34820043 ATGAAGAAAACCTTTTTCTAAGG - Intergenic
1095499061 12:42816558-42816580 TTTAAGAAAATCATTGCTTATGG + Intergenic
1098141411 12:67453632-67453654 AAGCAGAAAAGATTTGATTAGGG - Intergenic
1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG + Intergenic
1101499656 12:105290800-105290822 ATGTAGTACAGCTTTGTTTAAGG - Intronic
1102477146 12:113195997-113196019 ATGCTGAACAGCTTAGCTTAGGG - Intronic
1103025233 12:117568340-117568362 ATGAGGAAAAGCTTTGGTCCAGG + Intronic
1104182238 12:126393403-126393425 GAGAAGAAAAGTTTTGCTCAAGG - Intergenic
1104872011 12:132006363-132006385 AAGAGGAAAAGCTTTTCTCATGG - Intronic
1105671522 13:22622459-22622481 ATTAAGAAAAGCTTTGGAGAAGG - Intergenic
1105783673 13:23726307-23726329 CTGAAGAAATGCTTGGCTGATGG - Intergenic
1106298202 13:28437666-28437688 ATGAAGAAAAGTTTCACGTATGG + Intronic
1106809308 13:33343989-33344011 ATTAAGCAAAACTTTTCTTAGGG + Intronic
1108033024 13:46256672-46256694 ATGGAGAAAAGTTGTGCTTCTGG + Intronic
1108929523 13:55799642-55799664 ATGAATAAAAACTTTATTTATGG + Intergenic
1109451233 13:62517530-62517552 AAGAAGATAAGCTTATCTTATGG + Intergenic
1109613857 13:64804556-64804578 ATAAACAAAATATTTGCTTAAGG - Intergenic
1111249348 13:85583227-85583249 TTGAAGAAAAGCTTCCCTCAGGG + Intergenic
1111486306 13:88905416-88905438 GAGTAGAATAGCTTTGCTTAGGG - Intergenic
1111901421 13:94204067-94204089 CTGAAGAAAATCATTGCTTTGGG + Intronic
1112041288 13:95551256-95551278 AGGAAGAAAAGCTTTTTTAAAGG + Intronic
1112342874 13:98566876-98566898 ATGAAGAAAGGTATTGCTTGAGG - Intronic
1112630167 13:101152306-101152328 ATGAAGAGAAGCTCTGTTTTCGG + Intronic
1112977998 13:105345020-105345042 TTGAAGAAAAGGGTTTCTTAAGG - Intergenic
1114362430 14:21989615-21989637 CTGGAGAAAATCTTTGGTTAAGG + Intergenic
1114925105 14:27386703-27386725 TTGAAGAAAACATCTGCTTATGG + Intergenic
1120244532 14:81991287-81991309 ATGAGGATAAGCGTAGCTTATGG + Intergenic
1124601791 15:31138830-31138852 ATGAAGAAAATCTATTTTTAAGG + Intronic
1124970364 15:34483796-34483818 ATGAAGAAAAGCAATGTTTCAGG - Intergenic
1125067525 15:35507556-35507578 ATGAAAAATTGTTTTGCTTATGG - Intronic
1125498681 15:40222842-40222864 GTGAAGTAAAGCTTTGTTTCTGG + Intergenic
1127200737 15:56647228-56647250 ATGGAGAAAAGGTTGGTTTAGGG + Intronic
1127266309 15:57365204-57365226 AAAAAAAAAAGCTTTGCTTGGGG - Intergenic
1127762577 15:62153309-62153331 ATAAAGAAAAGCTTTGCCGTGGG + Intergenic
1127830142 15:62743388-62743410 GGGAAGAAAAGGTTTGCTTCTGG + Intronic
1128892649 15:71344605-71344627 ATGAAACAAAGATATGCTTACGG - Intronic
1131240395 15:90736714-90736736 ATGAGGAAAATCTTTGCAAACGG + Intronic
1131595280 15:93792190-93792212 ATCAAGAAAGGGTTTTCTTAGGG - Intergenic
1132394416 15:101461922-101461944 ATGAATAAAAGCATTGATTTTGG - Intronic
1133107269 16:3520457-3520479 ATGAAAAAAAGCCTTACATAAGG + Intronic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1135175734 16:20227118-20227140 ATTAAGCAAAGATTTGCCTATGG + Intergenic
1135375006 16:21938459-21938481 ATGCAGAAAGGCTTTGCTTCTGG + Intergenic
1137352698 16:47727431-47727453 CAGAAGAAGAGCTCTGCTTATGG - Intergenic
1137769611 16:51005393-51005415 AAGAAGAAAAGCTCAGCTTGGGG - Intergenic
1142797023 17:2316309-2316331 ATAAAGTCATGCTTTGCTTAAGG - Intronic
1143385704 17:6529230-6529252 AGGAAGAAAGGCTTTCCTTATGG - Intronic
1146252525 17:31361494-31361516 ATGAAGGAAAGCTTTTGTTATGG + Intronic
1147380605 17:40053498-40053520 ATGAAGAAATTCTTTCCTAAAGG - Exonic
1149393336 17:56214344-56214366 ATCAAGAAAAGCTTCGCAGAGGG + Intronic
1149797493 17:59534028-59534050 CTAAAGAAAAGCTTTTCTTCAGG + Intergenic
1150017938 17:61578296-61578318 AGGATGAAAAGCTTTGGTCAGGG - Intergenic
1151221196 17:72614317-72614339 ATGAAAGAAAGCTTGGCTTCAGG - Intergenic
1152770308 17:82163477-82163499 ATGAAGAACAGCTTCGCATTGGG - Intronic
1153706418 18:7750008-7750030 ATGAATAAGACCTTTGCTTAGGG - Intronic
1153751489 18:8236310-8236332 ATAAAGAAAAGCATTACATAAGG - Intronic
1154097279 18:11430229-11430251 CTGAAGAAATGCTTGGGTTAGGG - Intergenic
1154289417 18:13094376-13094398 ATGAGGAAGAGGTTTGCTTTTGG + Intronic
1154938649 18:21088728-21088750 ATGATGAACAGGTTTGATTAGGG + Intronic
1156093865 18:33505637-33505659 ATAAAGACAAGCTTTGCTAGTGG - Intergenic
1156794770 18:41030817-41030839 ATGTTGAAAAGCTATGATTAAGG + Intergenic
1156848190 18:41694061-41694083 ATGAAGACAAACTTTCCTTCTGG - Intergenic
1156942164 18:42781351-42781373 ATGAAGAAAAGCATTTATCAAGG - Intronic
1157428692 18:47605360-47605382 ATGAAGAAGTGCCTTGCTCAGGG + Intergenic
1157632858 18:49116843-49116865 ATGAAACAAAGTTTTGCCTAAGG - Intronic
1159743499 18:72202840-72202862 ATGAAGATAAACATAGCTTAAGG - Intergenic
1163009876 19:14418441-14418463 ATGAAAAAAAGATTTTCTTTTGG - Intronic
1163498112 19:17658560-17658582 GTGAAGAACAACTTTGCTGAAGG + Intronic
1163712984 19:18857866-18857888 ATGAAGAACAGCTGTTCTCAGGG + Intronic
1167036105 19:46995816-46995838 GTGAGGGCAAGCTTTGCTTAAGG + Intronic
925097332 2:1217753-1217775 GTGAAGAAAAGCATTGTTGATGG + Intronic
925530508 2:4855611-4855633 AGGAAAACAAGCTTAGCTTAGGG + Intergenic
926632031 2:15145464-15145486 ATAAAGGAAAGCTTTTATTATGG + Intergenic
927451106 2:23210170-23210192 AGGAAGAGAAGCTTTGCTTGAGG - Intergenic
928280768 2:29944329-29944351 ATGAGGAAAAACTGTGCTTCGGG - Intergenic
928387082 2:30879806-30879828 AGGAAGAAAATCTGTGCCTAGGG - Intergenic
928976293 2:37090008-37090030 ATGATGAAAAGCTCTCCATAAGG - Intronic
929644955 2:43617251-43617273 TTGAAGAAAAACATTGCTAAGGG + Intergenic
929855238 2:45632079-45632101 AGAAAGAAAAGCTTTTCTCAGGG - Intergenic
930353083 2:50282004-50282026 ATGAAGTAGGGCTTTGCTTTTGG - Intronic
930693339 2:54386760-54386782 ATAAAGAACAGGTGTGCTTATGG - Intergenic
931880892 2:66569593-66569615 ATAAACACAAGCTTTACTTAGGG + Intronic
933384630 2:81594259-81594281 ATGCAGAAATTCTTTGCTTAGGG + Intergenic
933738544 2:85514884-85514906 AGGATTAAATGCTTTGCTTAAGG - Intergenic
936595469 2:113843163-113843185 ATGCAGAAAAGATTTTCTTAAGG + Intergenic
936982003 2:118273275-118273297 ATCATGAAAAGCATTGGTTAAGG - Intergenic
938199051 2:129358125-129358147 AAGAAGAAAAGTTATACTTAAGG + Intergenic
939571961 2:143850846-143850868 ATTAAGGAAAACTTTGCTTTGGG + Intergenic
939603724 2:144226426-144226448 ATGACCAAAAGGTCTGCTTAAGG + Intronic
940083113 2:149827486-149827508 ATGAACAAAATTTTTGCTTTAGG + Intergenic
940192128 2:151052993-151053015 ATCAAGATAAGCTTGGCTTGTGG - Intergenic
940310390 2:152273140-152273162 GTGAGAAAAAGCTTTTCTTAAGG - Intergenic
940881841 2:158954468-158954490 AAGAAGAAAGGCTCTGCTCAGGG + Intergenic
940886884 2:158998010-158998032 ATGAAGAAAAGTTTCACTTTGGG + Intronic
941062419 2:160862831-160862853 ATGTAGAAAATTTTTGCTTTAGG + Intergenic
941384102 2:164832269-164832291 ATGATGTAAAGCTTTACTTTAGG + Intronic
941392023 2:164926274-164926296 ATGAAGGAAAGCTTTACATGTGG - Intronic
941675548 2:168340088-168340110 CTAAAGAAAGGCTTTGCTCAAGG + Intergenic
942505990 2:176642231-176642253 ATGAATCAAGGCTTTCCTTATGG - Intergenic
943602587 2:189939354-189939376 ATGAGGCAAATCTGTGCTTAAGG + Intronic
945313366 2:208342000-208342022 ATGAAGAAAAACTATTTTTAAGG - Intronic
945767120 2:213994972-213994994 ATAAAGAAAAGATTTAATTATGG + Intronic
945929068 2:215836840-215836862 ATGAAGAAAGGCATTGCTTAGGG - Intergenic
946108419 2:217392416-217392438 TTGAGGAAAAGCTGTGCTTATGG - Intronic
946264024 2:218522724-218522746 ATGAAGAAAAGGATTACTAAGGG - Intronic
946419254 2:219555857-219555879 AAAAAGAAAAGTTTTGCTTTGGG + Intronic
947110477 2:226713649-226713671 ATACAGAAAAGTTTTGCTTGGGG - Intergenic
947995698 2:234525421-234525443 ATGAAGAAAGGCTTTGGATCAGG + Intergenic
1168852596 20:986879-986901 AAGTAGAACAGCTTTGCGTATGG - Intronic
1169805889 20:9558809-9558831 ACGAAGCAAAGCATTGGTTATGG + Intronic
1170138917 20:13105504-13105526 ATGGAGAAAAGCTTCTCTTTAGG + Intronic
1171231335 20:23488947-23488969 ATGAAGAAAGGCTAGGCTGAAGG + Intergenic
1172433707 20:34913676-34913698 ATGAAGAAAGGGGTTGCTCATGG - Intronic
1173717062 20:45217655-45217677 CTGAAGGATAGCTTTGCTGAGGG + Intergenic
1173888143 20:46479862-46479884 AGAAAGAAATGCTTTGGTTAAGG - Intergenic
1174330095 20:49811257-49811279 CTGAAGACAAGGTTTGCTGACGG - Intergenic
1175634635 20:60570111-60570133 CTGAAGAAATGCTTTGTGTAGGG - Intergenic
1175650962 20:60722458-60722480 ATGATGATAAGATTTGCATACGG + Intergenic
1176938890 21:14899972-14899994 ATGCAGAAAAGCCTTTGTTAAGG + Intergenic
1177109852 21:17012599-17012621 ATGAAGAGAAGCTCTTTTTATGG - Intergenic
1177131374 21:17260282-17260304 ATAAAGAAAAAGTTTGCTCAGGG - Intergenic
1177852024 21:26359901-26359923 ATGAAGAAAAGGTGTGGTCAAGG + Intergenic
1179263111 21:39776014-39776036 ATGATGAAAAGATTGGATTATGG + Intronic
1180242928 21:46523918-46523940 AGGGAGAAAAGCATTGCCTATGG + Intronic
1182608032 22:31522430-31522452 ATGATGAAAAGTTTTGGGTATGG - Intronic
1183113420 22:35669919-35669941 AGGGAGAAAAGCACTGCTTATGG - Intergenic
949855984 3:8461776-8461798 ATGAAGTAAAATTTTGCTGAAGG + Intergenic
949980340 3:9498875-9498897 ATGAAGGAAAACTTTCCTGAGGG - Exonic
950826570 3:15829353-15829375 ATGAAGAAAATCTATACTCATGG + Intronic
951389707 3:22087721-22087743 TTGAAGTCAAGCTTTTCTTATGG + Intronic
951542931 3:23799559-23799581 ATGAAGAATATTTTTGCTTTTGG - Intergenic
952121722 3:30253031-30253053 ATAGAGAAGAGATTTGCTTAAGG + Intergenic
952161270 3:30695685-30695707 ATGAAGAAAAGCTCTGCTACTGG + Intergenic
952278129 3:31897253-31897275 AAAAAGAAGAGCTTTGCTAAGGG + Intronic
952325898 3:32320506-32320528 ATGCAGAAGAGATTTCCTTAGGG + Intronic
952566236 3:34661832-34661854 AAGAATTAAAGCTTTGCTTATGG + Intergenic
952745442 3:36772806-36772828 ATGAAGAAATGTTTATCTTAGGG + Intergenic
954290195 3:49645638-49645660 GTGAAGAAAAGCAATGCTGAAGG - Intronic
955619597 3:60848257-60848279 ATGTAGAAGAACTGTGCTTAAGG - Intronic
956007538 3:64797041-64797063 ATGGAGAAATGAATTGCTTATGG - Intergenic
956897238 3:73675214-73675236 TGGAAGAAAAGTTCTGCTTAGGG + Intergenic
957121495 3:76100469-76100491 ATGAACAAAAGGTTTGCAAATGG - Intronic
957225698 3:77442454-77442476 ATGAAGAAAAGGTTTTCATTGGG - Intronic
957417705 3:79928252-79928274 AGGAAGAAAGTATTTGCTTAGGG + Intergenic
958745844 3:98133071-98133093 ATAAAGTAAAGGTTTGCATATGG - Exonic
958748735 3:98169073-98169095 ATAAAGTAAAGGTTTGCATATGG - Exonic
958751549 3:98197581-98197603 ATAAAGTAAAGGTTTGCATATGG - Intronic
958752424 3:98207796-98207818 ATAAAGTAAAGGTTTGCATATGG - Intergenic
958754844 3:98238725-98238747 ATAAAGTAAAGCTTTGCAAATGG - Intergenic
958757282 3:98264706-98264728 ATAAAGTAAAGCTTTGCAAATGG - Exonic
958761363 3:98312286-98312308 ATAAAGTAAAGGTTTGCATATGG - Intergenic
959160699 3:102721102-102721124 AGGAAGAAAATCTTTCCATATGG - Intergenic
959317669 3:104829022-104829044 AAGAAGAAAAGCTCTGAATAAGG - Intergenic
960229095 3:115203725-115203747 ATTAACAAAAGCTTTGTATAAGG + Intergenic
960465209 3:117989578-117989600 GTTAAGAAAGTCTTTGCTTAAGG - Intergenic
960494538 3:118359249-118359271 AGTAAGAAAAGTTTTGCTAATGG + Intergenic
961561289 3:127732166-127732188 ATAAAAAATAGCTTTGCGTAAGG + Intronic
961579339 3:127866229-127866251 AAGAAGGAAAGCTTTGCGAATGG - Intergenic
961840198 3:129704162-129704184 ATGAAAAACAGCTTTGTTTTGGG + Intronic
963161015 3:142150194-142150216 ATGAACAAAATCTTTTCATATGG - Intergenic
966104436 3:176319389-176319411 GTGACCAAAATCTTTGCTTAGGG - Intergenic
966569202 3:181422025-181422047 ATAAAGAACAGCCTTTCTTAAGG - Intergenic
967399694 3:189046984-189047006 AACCAGAAAAGCTTTGTTTAAGG + Intronic
967591437 3:191279778-191279800 CTGAAGAAAAACTTTTCTCAAGG + Intronic
970220820 4:13808876-13808898 ATGAAGAAAAGCTATGGGTTTGG + Intergenic
970889011 4:21020942-21020964 ATGCAGTCATGCTTTGCTTAAGG + Intronic
971782397 4:31053757-31053779 ATAAAGTAAAACTTAGCTTAGGG - Intronic
971916879 4:32882344-32882366 ATGAAGAAAAGCAGTGATTTAGG + Intergenic
972048484 4:34698591-34698613 ATGAAAGAAAGATTTCCTTATGG + Intergenic
973229385 4:47824465-47824487 AGAAAGAAAAGCTTTTCCTAAGG - Intronic
973851757 4:54967736-54967758 GTGAAGAGAAGCTTTGCTCCAGG + Intergenic
974201246 4:58643602-58643624 ATGAATAAAATCATTGCTCAGGG + Intergenic
974413012 4:61566210-61566232 ATGAAGACAAGATTTGTTTCAGG + Intronic
975312250 4:72915561-72915583 GTGAAGAAAAGCATTTCATATGG - Intergenic
976043409 4:80915064-80915086 ATGAACCAAAGCAGTGCTTAGGG - Intronic
976609425 4:87014410-87014432 TTTAAGAAAAGCTTTGCCTAGGG + Intronic
977340497 4:95751403-95751425 ATGAAGCAAAGCGTGGCTAATGG - Intergenic
977734889 4:100402154-100402176 ACGAAGTAAAGCTTTGCAGAAGG + Intronic
977804545 4:101281183-101281205 ATGAGGAAAAGCTTTGGAGAGGG + Intronic
979511124 4:121555056-121555078 ATCAAGAATAGCTTTGATAAAGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
979922294 4:126513796-126513818 ATGAAGCAAAGCATTCCTGATGG + Intergenic
980146573 4:128992866-128992888 ATGTAGAAAAACTTTTCCTAAGG + Intronic
980406635 4:132361511-132361533 ATTAAGAAAAGTTTTGTTAATGG - Intergenic
980410856 4:132416404-132416426 ATGAAGAAAAGCTGTGATATGGG - Intergenic
980496198 4:133589418-133589440 ATGAAAACAAGCCTTTCTTAAGG + Intergenic
981377142 4:144028846-144028868 ATGCAGAAAATCTTTGCTGGGGG - Intergenic
981419726 4:144535306-144535328 ATGAAGAAAAGGTGTGCTAAGGG + Intergenic
981696256 4:147562116-147562138 ATGAAGAAGACCTTTGCTTAGGG + Intergenic
981959547 4:150519994-150520016 ATGGACAAAAGATTTGATTAGGG - Intronic
983139456 4:164131151-164131173 ATGAAAACAAGCTTTACTTGAGG + Intronic
984599336 4:181708486-181708508 ATGAAGAAAAGGTTTGGGTTTGG + Intergenic
986921366 5:12687242-12687264 TTTAAAAAAAGCTTTGCTTTAGG + Intergenic
988841969 5:35092183-35092205 ATGAAAAAAAGCTTCCCTTTGGG + Intronic
991557600 5:67913075-67913097 AGGAATAAAAGTTTTGCTTGGGG - Intergenic
992025518 5:72665430-72665452 ATGGAGAAAACCTTTGATTTGGG - Intergenic
992999308 5:82364597-82364619 ATGAAGAAAAGCTAGGCTCCTGG - Intronic
993238519 5:85347432-85347454 AAAAAGAAAAGATTTGTTTAGGG + Intergenic
993376530 5:87155354-87155376 TTGCAGTAAAGCGTTGCTTAAGG + Intergenic
993825976 5:92687167-92687189 ATGAAGAAAAACTTTGTTGAGGG + Intergenic
994567353 5:101467152-101467174 GTAAAGAAAAGCTTTGAATACGG - Intergenic
994894814 5:105688923-105688945 ATGAAGACATGCTTTCCTTGGGG + Intergenic
998628999 5:143877901-143877923 TTGAAGAAGAGCTTTGGTGATGG + Intergenic
1000204015 5:159039928-159039950 CTAAACAAAAGCTTTGCTTGAGG + Intronic
1000279503 5:159769933-159769955 ATGCAGAGATGCTTTGCTTTTGG + Intergenic
1000395499 5:160770560-160770582 ATGAAGAAGAGTGTTCCTTAGGG - Intronic
1001103226 5:168831218-168831240 CAAAAGAGAAGCTTTGCTTAAGG - Intronic
1001730211 5:173948333-173948355 AAGGAGAAAAGGTTTGCTTGTGG + Intronic
1001891383 5:175342139-175342161 ATAAAGTCAAGCTTTACTTATGG + Intergenic
1003047232 6:2744881-2744903 ATTCAGAAATGATTTGCTTAGGG + Intronic
1004246043 6:13977058-13977080 TTGAAGAATGGCTTTGATTAAGG - Exonic
1004610367 6:17233874-17233896 ATGAAGAAAAACTTTGGGTCTGG + Intergenic
1005326370 6:24705041-24705063 ATGAAGAAAAGCTTTGCTTAAGG - Exonic
1006713261 6:36094634-36094656 ATGAAAGAAATTTTTGCTTATGG - Intronic
1010274099 6:73949017-73949039 ATGTGGAATAGCTTTGCTCATGG + Intergenic
1010542383 6:77107786-77107808 ACTAATAAAAGCTTTGCTCATGG + Intergenic
1010629478 6:78180267-78180289 ATTTTGAAAAGCTTTGGTTATGG + Intergenic
1010945414 6:81968802-81968824 ATAGAGAAAAGCTTTAATTAAGG - Intergenic
1012162025 6:95897885-95897907 ATGAAGAAAAAAATTTCTTATGG - Intergenic
1012798797 6:103798690-103798712 ATGAATAACATGTTTGCTTATGG + Intergenic
1014117616 6:117683841-117683863 ATGCAGATAAGATTTGCTGATGG + Intronic
1015061924 6:128976529-128976551 AGGAAGAGATGCTTTGCTTGAGG + Intronic
1016404202 6:143713466-143713488 AAGAAGAGAAACTTGGCTTAAGG + Intronic
1017307529 6:152936487-152936509 TTGAAGAAAACATTTGTTTATGG - Intergenic
1018512401 6:164539701-164539723 ATGAAGAAAAATTTGCCTTATGG + Intergenic
1020465252 7:8471263-8471285 TACAAGAAAAGCTGTGCTTAAGG + Intronic
1024146629 7:46523492-46523514 AGGAAGAAAAGCATTGCCTGTGG - Intergenic
1026397429 7:69970441-69970463 AGGAAGAAAATCCTTGGTTAAGG - Intronic
1026535850 7:71238005-71238027 ATTGAGAGAAGCTGTGCTTAAGG + Intronic
1030037454 7:105420021-105420043 ATGAAAAAGAGCCTTGCCTATGG - Intergenic
1030434032 7:109492323-109492345 ATTTAGATAAGTTTTGCTTAGGG + Intergenic
1030623421 7:111817090-111817112 ATGAAGGAAAGGCTTTCTTAGGG - Intronic
1030765530 7:113404639-113404661 ATGAAGAAAGGCTTTATTTTTGG + Intergenic
1030916771 7:115324574-115324596 TTGAAGACATGCTTTGCTTTTGG + Intergenic
1031166755 7:118238688-118238710 ATGAAGAAATGCATGGGTTATGG - Intronic
1031563825 7:123269924-123269946 ATTATGAGAAGCTTTGCTTTGGG - Intergenic
1032225403 7:130027432-130027454 ATGAAGACAAGCTTTACTGTAGG - Intronic
1033778644 7:144643485-144643507 ATGAAGACAAGCTTGGTTAAGGG - Intronic
1034819012 7:154199429-154199451 ATGAATAATTGATTTGCTTAAGG + Intronic
1034950692 7:155295508-155295530 ATCAACAACAGCTTTGCTTGAGG + Intergenic
1036741885 8:11370518-11370540 AAAGAGAAAAGCTTTTCTTAAGG - Intergenic
1036929458 8:12940693-12940715 ATGTAGAAAAGCTTTGCTGTGGG + Intergenic
1037160375 8:15763624-15763646 ATAAATTAAAGCTTTGCTTAGGG + Intronic
1037224029 8:16561924-16561946 ATAAAGAAAAGCCTTGCTAATGG - Intronic
1039164403 8:34660958-34660980 ATGAATTAAAGCTTGGCTGAAGG - Intergenic
1040549147 8:48425066-48425088 AAGAAGAAAGGCCTTGCCTAAGG + Intergenic
1041878195 8:62714640-62714662 ATGAATACAAGCTATGTTTAGGG + Intronic
1042491005 8:69397528-69397550 ATGAAGAAAACATTTCCTTTCGG + Intergenic
1044076858 8:87832339-87832361 ATGAAAAAAGCCTTTGCTTATGG - Intergenic
1044924569 8:97199213-97199235 AGCAAGAAAAGATTTGATTAGGG + Intergenic
1045446856 8:102275429-102275451 AATAACAATAGCTTTGCTTAGGG - Intronic
1046830897 8:118744674-118744696 TGGAAACAAAGCTTTGCTTAAGG + Intergenic
1047053613 8:121139861-121139883 ATGAACATAAGATTTGCTGATGG + Intergenic
1051454251 9:17235716-17235738 ATGAAGAAAATGCTTTCTTAAGG + Exonic
1053092916 9:35296141-35296163 ATGAAGAGAAGTATTCCTTATGG - Intronic
1054315685 9:63583277-63583299 ATTAAGAAAACTTTTGCTTTTGG + Intergenic
1054705581 9:68458207-68458229 AAGAAGAAAAACTTGGCTTTAGG - Intronic
1055022210 9:71682537-71682559 ATAGAGAAATGCTTTGTTTAGGG + Intergenic
1056432599 9:86542954-86542976 ATGAAGAAAAACTTTACTTAAGG + Intergenic
1056729688 9:89155053-89155075 GTGAAGAAAAGCAATGCTCAAGG - Intronic
1058098831 9:100894904-100894926 ATTAATAAAAGTTTAGCTTATGG - Intergenic
1058225891 9:102362915-102362937 AGGGAGGACAGCTTTGCTTATGG + Intergenic
1058828819 9:108797459-108797481 ATTAAAACAAGCCTTGCTTAAGG + Intergenic
1058965302 9:110032036-110032058 AATAAGCAAAGCTTAGCTTACGG + Intronic
1059804704 9:117786261-117786283 ATGATGAAAAACATTGTTTAAGG + Intergenic
1061119331 9:128633657-128633679 ATGAAGAAAAGCAAAGCTTTGGG - Exonic
1062260328 9:135659276-135659298 CTGAAGTAAAGTTTTGCTCAAGG + Intergenic
1186360480 X:8836131-8836153 ATGAAAAGAAGCCCTGCTTATGG + Intergenic
1187355355 X:18565035-18565057 AAGAAGAAATACTATGCTTAGGG + Intronic
1188842608 X:35035155-35035177 ATGAAGGAAGGGTTTTCTTAAGG - Intergenic
1189414312 X:40801395-40801417 ATTAAAACAAGCCTTGCTTAAGG - Intergenic
1193310509 X:80002796-80002818 ATGAAATTAAGCTTTGCTTAGGG + Intergenic
1194109702 X:89818156-89818178 ATAAAGAAAAGCATTGCCTGTGG - Intergenic
1194184658 X:90760255-90760277 CTGAACAAAAGCTTTGGTAAGGG + Intergenic
1194946239 X:100071349-100071371 ATCAAGAAAAGCTTTGATGTAGG - Intergenic
1195520107 X:105820692-105820714 CTGAAGAGAATCTTTGCTAAAGG - Intergenic
1196650904 X:118167233-118167255 AAGAAGAAAAGCAGTGGTTAGGG - Intergenic
1196713038 X:118783256-118783278 ATGAAGAAAATCAGTGATTAGGG - Intronic
1197900212 X:131363481-131363503 ATTAAGAAAAGCTTTGGCTCTGG + Intronic
1198464085 X:136889138-136889160 ACAAAGAAAAGCAATGCTTATGG + Intergenic
1200462368 Y:3472894-3472916 ATAAAGAAAAGCATTGCCTGTGG - Intergenic
1200531255 Y:4342257-4342279 CTGAACAAAAGCTTTGGTAAGGG + Intergenic
1201928543 Y:19316283-19316305 ATGAACAAAAGCTTTGGTTGAGG + Intergenic