ID: 1005327307

View in Genome Browser
Species Human (GRCh38)
Location 6:24715280-24715302
Sequence CTGTGGGGATCTCTTGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005327297_1005327307 19 Left 1005327297 6:24715238-24715260 CCAGACCAGTATCTGGTTATCTC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1005327307 6:24715280-24715302 CTGTGGGGATCTCTTGGTTCAGG No data
1005327298_1005327307 14 Left 1005327298 6:24715243-24715265 CCAGTATCTGGTTATCTCCAGCA 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1005327307 6:24715280-24715302 CTGTGGGGATCTCTTGGTTCAGG No data
1005327299_1005327307 -3 Left 1005327299 6:24715260-24715282 CCAGCATTCTCCCCAAGTAACTG 0: 1
1: 0
2: 0
3: 13
4: 170
Right 1005327307 6:24715280-24715302 CTGTGGGGATCTCTTGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005327307 Original CRISPR CTGTGGGGATCTCTTGGTTC AGG Intronic
No off target data available for this crispr