ID: 1005332614

View in Genome Browser
Species Human (GRCh38)
Location 6:24764410-24764432
Sequence CTGTGGAGAAGGAGGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1005332614_1005332621 13 Left 1005332614 6:24764410-24764432 CCCTCTTACCTCCTTCTCCACAG No data
Right 1005332621 6:24764446-24764468 TCTCCTTCACCTTCAGAGTGAGG No data
1005332614_1005332624 22 Left 1005332614 6:24764410-24764432 CCCTCTTACCTCCTTCTCCACAG No data
Right 1005332624 6:24764455-24764477 CCTTCAGAGTGAGGACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1005332614 Original CRISPR CTGTGGAGAAGGAGGTAAGA GGG (reversed) Intergenic
No off target data available for this crispr